ID: 1056610087

View in Genome Browser
Species Human (GRCh38)
Location 9:88120479-88120501
Sequence CTAGGTCACCAGATCCCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056610087_1056610093 7 Left 1056610087 9:88120479-88120501 CCAGTAGGGATCTGGTGACCTAG No data
Right 1056610093 9:88120509-88120531 AAGCCTAGTCAGTGGGGACCTGG 0: 6
1: 0
2: 0
3: 48
4: 190
1056610087_1056610095 14 Left 1056610087 9:88120479-88120501 CCAGTAGGGATCTGGTGACCTAG No data
Right 1056610095 9:88120516-88120538 GTCAGTGGGGACCTGGTCAGTGG 0: 6
1: 25
2: 77
3: 157
4: 459
1056610087_1056610098 29 Left 1056610087 9:88120479-88120501 CCAGTAGGGATCTGGTGACCTAG No data
Right 1056610098 9:88120531-88120553 GTCAGTGGTGGCCTTATTAGTGG No data
1056610087_1056610096 17 Left 1056610087 9:88120479-88120501 CCAGTAGGGATCTGGTGACCTAG No data
Right 1056610096 9:88120519-88120541 AGTGGGGACCTGGTCAGTGGTGG No data
1056610087_1056610091 0 Left 1056610087 9:88120479-88120501 CCAGTAGGGATCTGGTGACCTAG No data
Right 1056610091 9:88120502-88120524 TCATTGGAAGCCTAGTCAGTGGG 0: 5
1: 12
2: 3
3: 7
4: 156
1056610087_1056610092 1 Left 1056610087 9:88120479-88120501 CCAGTAGGGATCTGGTGACCTAG No data
Right 1056610092 9:88120503-88120525 CATTGGAAGCCTAGTCAGTGGGG 0: 5
1: 13
2: 3
3: 8
4: 144
1056610087_1056610099 30 Left 1056610087 9:88120479-88120501 CCAGTAGGGATCTGGTGACCTAG No data
Right 1056610099 9:88120532-88120554 TCAGTGGTGGCCTTATTAGTGGG No data
1056610087_1056610090 -1 Left 1056610087 9:88120479-88120501 CCAGTAGGGATCTGGTGACCTAG No data
Right 1056610090 9:88120501-88120523 GTCATTGGAAGCCTAGTCAGTGG 0: 5
1: 10
2: 6
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056610087 Original CRISPR CTAGGTCACCAGATCCCTAC TGG (reversed) Intergenic
No off target data available for this crispr