ID: 1056610090

View in Genome Browser
Species Human (GRCh38)
Location 9:88120501-88120523
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 5, 1: 10, 2: 6, 3: 12, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056610082_1056610090 16 Left 1056610082 9:88120462-88120484 CCTCAGTGAAGGCCTCACCAGTA No data
Right 1056610090 9:88120501-88120523 GTCATTGGAAGCCTAGTCAGTGG 0: 5
1: 10
2: 6
3: 12
4: 117
1056610081_1056610090 19 Left 1056610081 9:88120459-88120481 CCTCCTCAGTGAAGGCCTCACCA No data
Right 1056610090 9:88120501-88120523 GTCATTGGAAGCCTAGTCAGTGG 0: 5
1: 10
2: 6
3: 12
4: 117
1056610087_1056610090 -1 Left 1056610087 9:88120479-88120501 CCAGTAGGGATCTGGTGACCTAG No data
Right 1056610090 9:88120501-88120523 GTCATTGGAAGCCTAGTCAGTGG 0: 5
1: 10
2: 6
3: 12
4: 117
1056610086_1056610090 4 Left 1056610086 9:88120474-88120496 CCTCACCAGTAGGGATCTGGTGA No data
Right 1056610090 9:88120501-88120523 GTCATTGGAAGCCTAGTCAGTGG 0: 5
1: 10
2: 6
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056610090 Original CRISPR GTCATTGGAAGCCTAGTCAG TGG Intergenic
900392420 1:2439402-2439424 TTCATGGGAAGCCAAGCCAGGGG + Intronic
901857464 1:12053513-12053535 GTCAGTGCAAGCCAAGGCAGTGG + Intergenic
902788797 1:18751037-18751059 GTCAGTGGCAGCCTAGGGAGGGG - Intergenic
908868017 1:68574316-68574338 GTCATTGGAATACTATTAAGAGG + Intergenic
916422012 1:164646477-164646499 GTCTTTGGCAGCCAGGTCAGAGG - Intronic
923145441 1:231194432-231194454 TTCATTGGAAGCCAAGTGTGAGG + Intronic
1068903316 10:62294602-62294624 GTCATTGAAAGCAGAGTAAGAGG - Intergenic
1070292833 10:75132049-75132071 TTCCTTGGAAGCCTAGGCAAAGG + Intronic
1077864773 11:6212957-6212979 GTCAGTGGAAGACAAATCAGAGG - Intronic
1079954353 11:26843894-26843916 CTAATTGGAAGCCTATACAGAGG + Intergenic
1083261575 11:61525938-61525960 CTCTTTGGAGGCTTAGTCAGAGG + Intronic
1087799101 11:102484619-102484641 GTTTTTGGAAGCCCAGTTAGGGG - Intronic
1088453821 11:110012610-110012632 ATCATTAGAAGCCATGTCAGAGG + Intergenic
1089079400 11:115763252-115763274 GACATAGGAAGCCCAGTCAAGGG + Intergenic
1090441917 11:126731313-126731335 GTCATTTGAGACCTAGGCAGTGG - Intronic
1091643252 12:2253539-2253561 GTCATTGGAACCTAAGTCCGTGG + Intronic
1092386238 12:8037731-8037753 GTCATTGGAAACCTGCTCATTGG + Intronic
1093093957 12:14951601-14951623 GTCAATGGAAACCTAGGAAGGGG - Intronic
1097201236 12:57280585-57280607 ATCCCTGGAAGCTTAGTCAGAGG + Intronic
1097277720 12:57824500-57824522 TCCATTGGAAGCCTGGTGAGGGG - Intronic
1098265984 12:68719698-68719720 TTAATTGAAAGCCTATTCAGGGG + Intronic
1105265463 13:18810520-18810542 GTCATTGGAAGCCTGGTCAGTGG - Intergenic
1110777225 13:79422061-79422083 GTCATTTGAAGCCCTGTCTGGGG + Intergenic
1114459211 14:22876284-22876306 GTCATTGGCAGCCTAGTGTGCGG + Exonic
1121133211 14:91469044-91469066 ATAATTGGTAGCTTAGTCAGTGG - Intronic
1121646802 14:95523967-95523989 TTCTTTGGAAGCATAGTAAGCGG - Intergenic
1123017677 14:105383142-105383164 GTCCTTGGAAGCCTGGGCTGAGG + Intronic
1202833036 14_GL000009v2_random:57583-57605 GTCATTGGAAGCCTGGTCAGTGG + Intergenic
1123698448 15:22896434-22896456 GTGATTGGAATCCTAGTAAGAGG - Intronic
1124062057 15:26302842-26302864 GTCATTGGAAGCCCATGCAGTGG + Intergenic
1142484495 17:237691-237713 ATCATTGAAAGCCTTGTCACTGG - Intronic
1143439579 17:6959076-6959098 GTAATTGGAAAGTTAGTCAGGGG - Intronic
1144493133 17:15731614-15731636 GTCAGTGAAGGCCTGGTCAGTGG + Intergenic
1144493139 17:15731629-15731651 GTCAGTGGGGGCCTGGTCAGTGG + Intergenic
1144640781 17:16935434-16935456 GTCAGTGGGGGCCTAGTTAGTGG - Intronic
1144907116 17:18645023-18645045 GTCAGTGGGGGCCTGGTCAGTGG - Intronic
1144907122 17:18645038-18645060 GTCAGTGAAGGCCTGGTCAGTGG - Intronic
1146021145 17:29280260-29280282 GTCATTTGAAGCCAAGTCTTTGG - Intronic
1149468944 17:56900810-56900832 GTAATAGGAAGCCTAGTGAGAGG + Intronic
1150384755 17:64749730-64749752 GAAATTAGAAACCTAGTCAGAGG + Intergenic
1150771608 17:68046764-68046786 GAAATTAGAAACCTAGTCAGAGG - Exonic
1151647353 17:75442303-75442325 GTCATTGGAAGGCTTGGCTGGGG - Intronic
1154422933 18:14251006-14251028 GTCATTGGAAGCCTGGTCAGTGG + Intergenic
1157435957 18:47669520-47669542 GTCAGTGGAAGTCTGGGCAGTGG + Intergenic
1159237529 18:65696597-65696619 GTCATTCAAACCCTATTCAGAGG + Intergenic
1163232446 19:16013802-16013824 GTCATCAGAAGCCTAGTCAGTGG + Intergenic
1163232998 19:16016439-16016461 ACCATTGGAAGCCTGGCCAGTGG + Intergenic
1163236119 19:16031612-16031634 GTCAGTGGGGGCCTTGTCAGTGG + Intergenic
1163236246 19:16032178-16032200 GTCAGTGGGCGCCTGGTCAGCGG + Intergenic
1163236261 19:16032252-16032274 GTCATTGGAAACCTGGCCACTGG + Intergenic
1163236334 19:16032590-16032612 GGCAATGGAAGCCTCATCAGTGG + Intergenic
1163236343 19:16032633-16032655 GTCACTGGAGGACTGGTCAGTGG + Intergenic
1163236593 19:16033751-16033773 GTCAGTGGGGGCCTGGTCAGTGG + Intergenic
1163860107 19:19738296-19738318 GTCATTAGGAACCTGGTCAGGGG + Intergenic
1163863399 19:19754143-19754165 GTCAGTGGAAGCCTCGGCAGTGG - Intergenic
1163863673 19:19755427-19755449 GTCATTTAAGGCCCAGTCAGTGG - Intergenic
1163863837 19:19756123-19756145 ATCATTGGAGACCTAGTCAGAGG - Intergenic
1167788577 19:51656184-51656206 CTCACTGGAAGCCAAGTCAAGGG - Intergenic
1202639638 1_KI270706v1_random:70127-70149 GCCATAGGAAGCCTGGTCAGTGG - Intergenic
926530064 2:14033135-14033157 GTCATTTGAAGGCTTGACAGGGG - Intergenic
934495032 2:94789160-94789182 GTCATTAGAGGCCTCATCAGTGG - Intergenic
934495060 2:94789306-94789328 GTCAGTGGGAACCTGGTCAGTGG - Intergenic
934495115 2:94789566-94789588 GTCATTGGAAGCCTGGTCCATGG - Intergenic
942608596 2:177717689-177717711 ATCATTGGAGGCCTGCTCAGAGG - Intronic
943201881 2:184837856-184837878 GCCAGTGGAAGCCTTCTCAGTGG + Intronic
945840774 2:214885328-214885350 GTCATTGGAAGCATACTGATTGG + Intergenic
947577089 2:231284356-231284378 GTCATTGGTAGCTTAGTGATAGG - Intronic
948403817 2:237702906-237702928 GTTATTTGAAGACAAGTCAGAGG + Intronic
948462370 2:238136353-238136375 GTCATCGGAAGCCTGGCCTGGGG + Intergenic
1170001993 20:11625198-11625220 GTCTTTGGAAGGCTTGACAGGGG + Intergenic
1171883131 20:30632412-30632434 GTCCGTGGAAACCTAATCAGTGG - Intergenic
1171886305 20:30654482-30654504 GTCATTGGAAGCCTGGTCAGTGG - Intergenic
1171986847 20:31666610-31666632 GTCATTTGAGGCCAATTCAGGGG + Intronic
1172758435 20:37304898-37304920 GTCATTTGAAGCCACGGCAGGGG + Intronic
1173017001 20:39234774-39234796 GTCATGGGAGGCCTGGCCAGGGG + Intergenic
1176647965 21:9367726-9367748 GTCACTGGAAGCCTGGTCAGTGG - Intergenic
1176850526 21:13908942-13908964 GTCATTGGAAGCCTGGTCAGTGG - Intergenic
1180362304 22:11911743-11911765 GCCATTGGAAGCCTGGTCAGTGG + Intergenic
1182453502 22:30435057-30435079 CTGATTGGAAGCCTTCTCAGGGG - Intergenic
949174974 3:1050249-1050271 GTCATTTGAAGCCAAGGCAGTGG - Intergenic
955045487 3:55355618-55355640 GACATTGGAAGCCTTGTGCGTGG - Intergenic
959693927 3:109229756-109229778 CTCATTTCAAGCCTAGTGAGAGG + Intergenic
962929455 3:140023265-140023287 GTCATTGGAGGCTTAGACATGGG + Intronic
1202738920 3_GL000221v1_random:37261-37283 GTCATTGGAAGCCTGGTCAGTGG + Intergenic
969422089 4:7103414-7103436 GTGATTGGAAGCCTGGTGGGCGG - Intergenic
969571856 4:8013725-8013747 GTCACAGGAAGCAAAGTCAGTGG - Intronic
969849394 4:9944358-9944380 GTTTTTGGAATCTTAGTCAGTGG + Intronic
973366793 4:49214728-49214750 GTCCATGGAAACCTAATCAGTGG - Intergenic
973369887 4:49236480-49236502 ATCATTGGAAGCCTGGTCAGTGG - Intergenic
973391145 4:49558932-49558954 ATCATTGGAAGCCTGGTCAGTGG + Intergenic
974762071 4:66289961-66289983 GTCATTGGAATGATAGTAAGTGG - Intergenic
977772187 4:100872792-100872814 GCCACAGGAACCCTAGTCAGAGG - Intronic
979009016 4:115342939-115342961 GTTACTGGAAGCATAGTCAAGGG + Intergenic
1202766995 4_GL000008v2_random:155982-156004 GTCATTGGAAGCCTGGTCAGTGG - Intergenic
989313443 5:40048787-40048809 TTCATTGAAAGCCTATTCTGAGG + Intergenic
996177583 5:120378635-120378657 GTCATCTGAAGTCTAGGCAGAGG - Intergenic
996475310 5:123912509-123912531 CTCTTTGGTAGCCTAGTCTGAGG + Intergenic
996922776 5:128788374-128788396 GTCAATAGTAGCCTACTCAGTGG - Intronic
1002838198 6:883275-883297 GTCTTTGGAAGCTAAGCCAGAGG - Intergenic
1015255022 6:131169493-131169515 GTTATTGGTTGCCTATTCAGAGG + Intronic
1022342039 7:29477766-29477788 GTCTTTGGAAGCTGAGGCAGTGG + Intronic
1022978570 7:35580757-35580779 GTCATTGGAAGGCTTGACTGGGG + Intergenic
1023259505 7:38344705-38344727 GTCATAGGAAGCAGAGTGAGTGG + Intergenic
1023259967 7:38349030-38349052 GTCATAGGAAGCAGAGTGAGTGG + Intergenic
1023260950 7:38358187-38358209 GTCATAGGAAGCAGAGTGAGTGG + Intergenic
1026217283 7:68360925-68360947 TTCATTGGGAACCTAGTCAGTGG - Intergenic
1031389974 7:121202134-121202156 GTGTTTGGAAGCCAGGTCAGAGG - Intronic
1037682220 8:21106928-21106950 GCCATTGGAAGACTAAGCAGAGG - Intergenic
1039727447 8:40234072-40234094 TACATTGGAAGCTTTGTCAGTGG + Intergenic
1040101569 8:43511380-43511402 GTCATTGGAAGACTGGTTAGTGG + Intergenic
1040101603 8:43511529-43511551 GTCAGTGGGAGCCTAGTCAGGGG + Intergenic
1040104708 8:43535104-43535126 GTCAGTGAAGGCCTACTCAGTGG + Intergenic
1041527212 8:58820620-58820642 GTCACTTGAAGCCAAGTCTGCGG + Intronic
1048852684 8:138659686-138659708 GGCATTGGAAACTCAGTCAGAGG + Intronic
1052876794 9:33573890-33573912 GTCATCGGAAGCCTAGTCAGTGG + Intergenic
1052876827 9:33574045-33574067 GTCAGTGAGAGCCTGGTCAGAGG + Intergenic
1052876848 9:33574150-33574172 GTCAGTGGGAACCCAGTCAGTGG + Intergenic
1053295344 9:36909079-36909101 GTGTTTGGAAGGCTACTCAGAGG - Intronic
1053499181 9:38570341-38570363 GTCAGTGAGAGCCTGGTCAGAGG - Intronic
1053499212 9:38570496-38570518 GTCATTGGAAGCCTAGTCAGTGG - Intronic
1053662060 9:40291048-40291070 GTCAGTGGGAACCTGGTCAGTGG + Intronic
1053662089 9:40291194-40291216 GTCATTAGAGGCCTCATCAGTGG + Intronic
1053912454 9:42920956-42920978 GTCATTGGAAGCCCAGTTCATGG + Intergenic
1053912509 9:42921216-42921238 GTCAGTGGGAACCTGGTCAGTGG + Intergenic
1053912538 9:42921362-42921384 GTCATTAGAGGCCTCATCAGTGG + Intergenic
1053916248 9:42947328-42947350 GTCAGTGAAATCCTTGTCAGTGG + Intergenic
1054374187 9:64437288-64437310 GTCAGTGGGAACCTGGTCAGTGG + Intergenic
1054374216 9:64437434-64437456 GTCATTAGAGGCCTCATCAGTGG + Intergenic
1054377804 9:64462266-64462288 GTCAGTGAAATCCTTGTCAGTGG + Intergenic
1054522521 9:66085090-66085112 GTCATTAGAGGCCTCATCAGTGG - Intergenic
1054522550 9:66085236-66085258 GTCAGTGGGAACCTGGTCAGTGG - Intergenic
1055062301 9:72082382-72082404 GTTATTGGTAGCCTTGTAAGGGG - Intergenic
1055456575 9:76477863-76477885 GTAAGTGGAATCCTAGTGAGAGG + Intronic
1056586695 9:87932059-87932081 GTCATTAGGGGCCTTGTCAGTGG - Intergenic
1056586787 9:87932440-87932462 GTCATTGGAAGCCTAGTCAGTGG - Intergenic
1056610090 9:88120501-88120523 GTCATTGGAAGCCTAGTCAGTGG + Intergenic
1056610150 9:88120761-88120783 GTCAGTGGGAACCCAGTCAGTGG + Intergenic
1056610181 9:88120882-88120904 GTCATTAGGGGCCTTGTCAGTGG + Intergenic
1057162176 9:92896448-92896470 GTCATTAGGGGCCTTGTCAGTGG - Intergenic
1057162208 9:92896569-92896591 GTCAGTGGGAACCCAGTCAGTGG - Intergenic
1057162265 9:92896829-92896851 GTCATTGGAAGCCTAGTCAGTGG - Intergenic
1057638214 9:96791613-96791635 GGTATTGGAAGCCTAGTCAAGGG - Intergenic
1057678633 9:97154978-97155000 GTCATTGGAAGCCTAGTCAGTGG - Intergenic
1057723492 9:97552325-97552347 GTTTTGGGAAGGCTAGTCAGAGG - Intronic
1057874112 9:98740366-98740388 AGCATTGGATGCCAAGTCAGAGG + Intronic
1203707648 Un_KI270742v1:67705-67727 GTCATTGGAAGCCTGGTCAGTGG + Intergenic
1203547713 Un_KI270743v1:140702-140724 GTCAGTGAAGGCCTGGTCAGAGG - Intergenic
1203547746 Un_KI270743v1:140859-140881 GTCATTGGAAGCCTGGTCAGTGG - Intergenic
1188503859 X:30859772-30859794 GTCAGTGGAAGCCTCCTTAGAGG - Intronic
1201344056 Y:12963480-12963502 GTCCTGGAAAGCCTAGCCAGAGG - Intergenic