ID: 1056610095

View in Genome Browser
Species Human (GRCh38)
Location 9:88120516-88120538
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 6, 1: 25, 2: 77, 3: 157, 4: 459}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056610089_1056610095 -4 Left 1056610089 9:88120497-88120519 CCTAGTCATTGGAAGCCTAGTCA No data
Right 1056610095 9:88120516-88120538 GTCAGTGGGGACCTGGTCAGTGG 0: 6
1: 25
2: 77
3: 157
4: 459
1056610087_1056610095 14 Left 1056610087 9:88120479-88120501 CCAGTAGGGATCTGGTGACCTAG No data
Right 1056610095 9:88120516-88120538 GTCAGTGGGGACCTGGTCAGTGG 0: 6
1: 25
2: 77
3: 157
4: 459
1056610086_1056610095 19 Left 1056610086 9:88120474-88120496 CCTCACCAGTAGGGATCTGGTGA No data
Right 1056610095 9:88120516-88120538 GTCAGTGGGGACCTGGTCAGTGG 0: 6
1: 25
2: 77
3: 157
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056610095 Original CRISPR GTCAGTGGGGACCTGGTCAG TGG Intergenic
900321696 1:2087767-2087789 GTTAGTGGGTACCCGGTTAGGGG - Intronic
900322191 1:2090368-2090390 GTCAGGGAGCACCTGTTCAGAGG + Intronic
901777014 1:11567060-11567082 GTCAGGGGGCACCTGGACAGTGG + Intergenic
901813375 1:11780011-11780033 GTGAGTGGAGACTTGGTCGGGGG + Intronic
902449018 1:16484988-16485010 TTCAGAGGCCACCTGGTCAGTGG - Intergenic
902505736 1:16938296-16938318 TTCAGAGGCCACCTGGTCAGTGG + Intronic
902526839 1:17064364-17064386 GGCAGAGGGGACCTGGCCAAAGG + Intergenic
903154722 1:21435963-21435985 TTCAGAGGCCACCTGGTCAGTGG + Intergenic
903211970 1:21823669-21823691 GACGGTGAGGAGCTGGTCAGCGG - Exonic
903226328 1:21895936-21895958 GGCAGTGGGGACCTGGGCAGCGG - Exonic
905074350 1:35256570-35256592 GCCTGTGGGCACCTGGTGAGAGG + Intergenic
906961725 1:50423064-50423086 GTGGGTGGAGACCTGGTCTGCGG - Intronic
908352028 1:63295452-63295474 GTCAGTGGGGGCGTGGTGTGGGG + Intergenic
912839087 1:113023100-113023122 GACAGTGGGGAAAGGGTCAGAGG - Intergenic
915221731 1:154380060-154380082 GACTGTGGGGAGCTGGGCAGAGG + Intergenic
919738365 1:200967874-200967896 GCCACTGGGGAACTGGTCACGGG - Intergenic
920428583 1:205899111-205899133 TTCACTGGGGAGCTGGTCAGTGG + Intergenic
920429484 1:205907898-205907920 TTCACAGGGGAGCTGGTCAGTGG + Intergenic
923041515 1:230323264-230323286 GACAGGATGGACCTGGTCAGAGG - Exonic
924624241 1:245686575-245686597 ATCAGCGGGGTCCTGGACAGCGG + Exonic
1062958297 10:1554466-1554488 GACAGTGGAGACCGGGGCAGAGG - Intronic
1063383513 10:5601698-5601720 GCAAGTGAGGGCCTGGTCAGGGG - Intergenic
1064319937 10:14295613-14295635 TCCAGTGGGGACATGGTGAGAGG + Intronic
1065784716 10:29202535-29202557 GTCAGTGGGAACCGGATCAGCGG + Intergenic
1065963848 10:30754962-30754984 GTCAGTGGGTACATGGGCTGGGG - Intergenic
1067474495 10:46556816-46556838 GACAGTGGGGACCCGGCCTGAGG - Intergenic
1068961154 10:62867888-62867910 GTCTGTTGGGATCTGGTCACAGG - Intronic
1069559075 10:69416927-69416949 GCCAGTGGGGGCCTTGGCAGAGG + Intergenic
1070855579 10:79605910-79605932 GTCAGAGGGGACCAGGGCATTGG - Intergenic
1071250386 10:83812689-83812711 GTCAGTGGGGAGTGGGTAAGAGG - Intergenic
1072018885 10:91379374-91379396 GGCAGTGGGGAGCTGGGCACAGG - Intergenic
1073151359 10:101313796-101313818 GTCAGTGGGCCCCTGCTCACAGG - Intergenic
1074243600 10:111664882-111664904 GTCACTGTGGACCTGGCCAGAGG + Intergenic
1075722987 10:124598166-124598188 CCCACTGGGGACCTGGTGAGGGG - Intronic
1075930236 10:126289187-126289209 GTCAGCTGGGGCCTGGTCAGAGG - Intronic
1075984747 10:126775126-126775148 GTCAATGGGCACTTAGTCAGTGG - Intergenic
1076979081 11:195776-195798 GTTACAGGGGACCTGGTGAGGGG + Intronic
1077098927 11:812634-812656 GTAAGTGGTGGCCTGGTGAGTGG + Intronic
1077882662 11:6363513-6363535 GTCACTGAGGCTCTGGTCAGTGG - Intergenic
1079124695 11:17710059-17710081 GGCTGTGGGGACCTGGAGAGGGG - Intergenic
1080833086 11:35914716-35914738 GCCAGTGAGGATCTGGTAAGAGG - Intergenic
1080973299 11:37303987-37304009 CCCAGTGGGGACTTGGTGAGGGG + Intergenic
1081622841 11:44629096-44629118 GTCATTGGGGCCATGGTCTGGGG - Intergenic
1081904890 11:46662051-46662073 GTCAGCAGTGATCTGGTCAGGGG + Intronic
1083077384 11:60055244-60055266 GTCAGTGGGGACGTGATCACAGG - Intergenic
1083291986 11:61695586-61695608 GTTTGTGGGGACCTGGCCACAGG + Intronic
1084014214 11:66369223-66369245 ATCAGTGGGGCCCAGGCCAGAGG + Intronic
1084148024 11:67275311-67275333 GACAGTGCGGACCTGGCCTGTGG - Intronic
1084164530 11:67369195-67369217 GTCAGTGAGGACTTCGGCAGTGG + Intronic
1085751625 11:79167315-79167337 GCCAGTGGGGACCTGTTGAAGGG + Intronic
1089204714 11:116750563-116750585 GGAAGTGGGGATGTGGTCAGGGG - Intronic
1090228390 11:125085077-125085099 ATCTGTGGGGGCCTGGTCAATGG + Exonic
1094319695 12:29171517-29171539 GACAGTGGGCAGCTGGGCAGAGG - Intronic
1094319745 12:29171753-29171775 GACAGTGGGCAGCTGGGCAGAGG - Intronic
1095380556 12:41585756-41585778 GTCTTTGGGGACTTGGGCAGTGG - Intergenic
1095916406 12:47484642-47484664 GACAATGGGGACCAGGACAGGGG - Intergenic
1096524278 12:52201265-52201287 GTCCGTGTGGACTTGGGCAGGGG - Intergenic
1099574320 12:84361820-84361842 CGCTTTGGGGACCTGGTCAGTGG + Intergenic
1101637458 12:106556943-106556965 CTCAATGAGCACCTGGTCAGAGG + Intronic
1103915285 12:124372780-124372802 GTGGGTAGGGGCCTGGTCAGGGG - Intronic
1104431485 12:128720013-128720035 GTCAGTGGTGTCCTGGTGAACGG - Intergenic
1105026530 12:132852922-132852944 GTCAGAGGAGAGCTGGGCAGGGG - Intronic
1105256289 13:18745682-18745704 GTCAGCAGGGACCTGTTCAGTGG - Intergenic
1105256374 13:18746116-18746138 GTCAGAGAGGACTTGATCAGTGG - Intergenic
1105256453 13:18746504-18746526 ATCAGTGTGGGCCTGCTCAGTGG - Intergenic
1105265365 13:18810090-18810112 ATCACTGGGAACCTGGTCAGCGG - Intergenic
1105265381 13:18810149-18810171 GTCAGTGGGGACTTGATCAGTGG - Intergenic
1105265396 13:18810221-18810243 GTCAGTGGAAAATTGGTCAGTGG - Intergenic
1105265399 13:18810236-18810258 GTCACTGGGGACCAGGTCAGTGG - Intergenic
1105265426 13:18810362-18810384 GTCAGTGAGGGCCTGGTCAGAGG - Intergenic
1105265463 13:18810520-18810542 GTCATTGGAAGCCTGGTCAGTGG - Intergenic
1108611912 13:52092512-52092534 GTCAGTGGCTGCCTGGTGAGAGG + Intronic
1109266382 13:60205551-60205573 GACAGTGGGCAGCTGGGCAGAGG - Intergenic
1109266389 13:60205590-60205612 GACAGTGGGCAGCTGGGCAGAGG - Intergenic
1110475357 13:75907249-75907271 GTCAGTAGGGACCGGGTGGGAGG + Intergenic
1113475999 13:110581904-110581926 GTCAGTGGAGACCAGGTTGGGGG - Intergenic
1113505558 13:110813498-110813520 GTCAGTGGAGGCGTGGTGAGGGG - Intergenic
1113993208 14:16045278-16045300 TTCAGTGGGGACCTTGTGGGTGG - Intergenic
1115785934 14:36826253-36826275 GTCAGTGGGGACCTCTTGAATGG + Intronic
1116124845 14:40771212-40771234 GACAGTGGGGTCATGTTCAGTGG - Intergenic
1117631729 14:57700382-57700404 GTCAGTGAGCAACTGGTAAGTGG + Intronic
1118704126 14:68464590-68464612 GTCAGTAGTAACCTGGTGAGGGG - Intronic
1120175521 14:81289398-81289420 ATAAGTGGGGGACTGGTCAGTGG + Intronic
1120333441 14:83123294-83123316 GTGGGAGGGGACCTGGTGAGAGG + Intergenic
1120978090 14:90267035-90267057 GTCAGTGAGGACCTTGACAAGGG - Intronic
1121791678 14:96704086-96704108 GAGAGTGGGGAGCTGGGCAGGGG + Intergenic
1122114095 14:99519004-99519026 CTAAGTGGGTACCTAGTCAGTGG - Intronic
1122362159 14:101173965-101173987 GCCCGTGGGAACCTGGTGAGGGG - Intergenic
1122430014 14:101634694-101634716 CTCAGTGGGGAGCAGGTCTGGGG + Intergenic
1122871064 14:104639299-104639321 GTCAGTGGGGACCCATTCTGTGG + Intergenic
1123118477 14:105905450-105905472 GCCAGTGAGGTCCAGGTCAGGGG + Intergenic
1202833036 14_GL000009v2_random:57583-57605 GTCATTGGAAGCCTGGTCAGTGG + Intergenic
1202833072 14_GL000009v2_random:57740-57762 GTCAGTGAGGGCCTGGTCAGAGG + Intergenic
1202833097 14_GL000009v2_random:57866-57888 GTCAATGGGGACCAGGTCAGTGG + Intergenic
1202833100 14_GL000009v2_random:57881-57903 GTCAGTGGAAAATTGGTCAGTGG + Intergenic
1202833117 14_GL000009v2_random:57953-57975 GTCAGTGGGGACTTGATCAGTGG + Intergenic
1202833131 14_GL000009v2_random:58019-58041 ATCACTGGGAACCTGGTCAGGGG + Intergenic
1202835583 14_GL000009v2_random:75602-75624 ATCAGTGTGGGCCTGCTCAGGGG + Intergenic
1202835702 14_GL000009v2_random:76214-76236 GTCAGTAAGGTCCTCGTCAGTGG + Intergenic
1202835729 14_GL000009v2_random:76345-76367 GTCACCAGGGACCTGGTCAGTGG + Intergenic
1202837601 14_GL000009v2_random:90238-90260 ATCAGTGTGGGCCTGGTCAGTGG + Intergenic
1202837667 14_GL000009v2_random:90567-90589 ATCAGTGAGGCCCTTGTCAGTGG + Intergenic
1202837684 14_GL000009v2_random:90640-90662 GTCAGAGAGGACTTGGTCAGTGG + Intergenic
1202837748 14_GL000009v2_random:90958-90980 GTCAGTAAGGTCCTGGTCGGTGG + Intergenic
1202837758 14_GL000009v2_random:91002-91024 GGCAGTGGGGGCCTTGTTAGTGG + Intergenic
1202906986 14_GL000194v1_random:80368-80390 ATCAGTGTGGGCCTGGTCAGTGG + Intergenic
1202907055 14_GL000194v1_random:80697-80719 ATCAGTGAGGCCCTTGTCAGTGG + Intergenic
1202907073 14_GL000194v1_random:80770-80792 GTCAGAGAGGACTTGGTCAGTGG + Intergenic
1123449442 15:20350839-20350861 GTCACTGGGCACCTGCTCAGTGG - Intergenic
1124060720 15:26291511-26291533 GGGAGTGGGCACCTGGCCAGAGG - Intergenic
1128053686 15:64684353-64684375 GTCTGTGAGGGCCTGGGCAGGGG - Exonic
1128453076 15:67818332-67818354 GTCAAGTGGGACCTGGTCTGGGG + Intergenic
1130199373 15:81810745-81810767 GCCAGTCTGCACCTGGTCAGAGG + Intergenic
1130985440 15:88841921-88841943 GTCAGTGGGGAGATGGGGAGGGG - Intronic
1131593749 15:93775626-93775648 CTCAGTGGGAGACTGGTCAGAGG + Intergenic
1132016753 15:98324596-98324618 GTCAGTGGGGACCATCTCAGGGG + Intergenic
1132076841 15:98828584-98828606 GTCAGTGGGAACGTGATGAGAGG - Intronic
1132346434 15:101111787-101111809 GTTGGTGGGGACCTGGACACCGG + Intergenic
1132358269 15:101189835-101189857 GACAGTGGAGGCCTGGTGAGTGG + Intronic
1132657986 16:1049232-1049254 GGCCCTGGGGACCTGGGCAGGGG + Intergenic
1132903381 16:2270204-2270226 GTCAGTGGGGCCCTGGGCATGGG - Intergenic
1133393791 16:5430092-5430114 GTCAGTGGAGAATTTGTCAGAGG - Intergenic
1133905870 16:10021747-10021769 GTCAGGGGAGACAGGGTCAGTGG + Intronic
1134042135 16:11076800-11076822 GGCAGGGTGGACCTGGTCAGTGG - Intronic
1134833254 16:17340580-17340602 GTGAGTGGGGAGCTGGTCTTTGG - Intronic
1135647533 16:24176074-24176096 GGAAGTGGGGACCTTGTCAGAGG + Intronic
1136380514 16:29892482-29892504 GGCAGTAGGGACCTGGTTATTGG - Intronic
1136912570 16:34157000-34157022 TTCAGTGGGGACCTTGTGGGTGG - Intergenic
1137718098 16:50611201-50611223 GGCAGGGGGGACCTGGAGAGAGG - Intronic
1137810778 16:51350484-51350506 GTCAGTGGGGGCCTGATCAGTGG + Intergenic
1140084054 16:71777880-71777902 GACAGAGGGGCCCTGGACAGTGG + Intronic
1142141586 16:88475114-88475136 GTTGATGGGGATCTGGTCAGAGG + Intronic
1142240948 16:88944786-88944808 GTCTGTGGGGCCCTGGCCAAAGG + Intronic
1142466571 17:140594-140616 GTTACAGGGGACCTGGTGAGGGG + Intergenic
1142566117 17:841392-841414 GTCAGGGGGGACCTGCTCGCCGG - Intronic
1142566156 17:841546-841568 GTCAGGGGGGACCTGCTCGCCGG - Intronic
1142566190 17:841701-841723 GTCAGGGTGGACCTGCTCACCGG - Intronic
1142766063 17:2064983-2065005 GTCAGTGGAGCCCTTCTCAGGGG + Intronic
1143014072 17:3882553-3882575 GTCATCCAGGACCTGGTCAGAGG + Exonic
1144362003 17:14504614-14504636 GTCAGTGAGGGATTGGTCAGAGG + Intergenic
1144493133 17:15731614-15731636 GTCAGTGAAGGCCTGGTCAGTGG + Intergenic
1144493139 17:15731629-15731651 GTCAGTGGGGGCCTGGTCAGTGG + Intergenic
1144493434 17:15733032-15733054 GTCAGCGAGGACATGGTCAGTGG + Intronic
1144493450 17:15733106-15733128 GTCAGTGAAAAACTGGTCAGTGG + Intronic
1144640493 17:16934087-16934109 GGAAGTGGGGACCTGGGCAGCGG - Intronic
1144640781 17:16935434-16935456 GTCAGTGGGGGCCTAGTTAGTGG - Intronic
1144640816 17:16935583-16935605 GTCAGTGGGGACCTGGTAAGTGG - Intronic
1144640827 17:16935627-16935649 GTCAGTGAGGACCTGGTCACTGG - Intronic
1144906812 17:18643546-18643568 GTCAGTGAAAAACTGGTCAGTGG - Intronic
1144906828 17:18643620-18643642 GTCAGCGAGGACATGGTCAGTGG - Intronic
1144907116 17:18645023-18645045 GTCAGTGGGGGCCTGGTCAGTGG - Intronic
1144907122 17:18645038-18645060 GTCAGTGAAGGCCTGGTCAGTGG - Intronic
1145367660 17:22278348-22278370 GGCAGTGGCGCCCTTGTCAGGGG - Intergenic
1145398549 17:22514189-22514211 GGCAGTGGGGCCCTGGGCACTGG - Intergenic
1146722574 17:35133418-35133440 GACAGTCGGCTCCTGGTCAGCGG - Exonic
1148052928 17:44778021-44778043 GTGGGTGGGGACGTGGGCAGGGG - Exonic
1152108973 17:78346712-78346734 CACAGTGGGAACCTGGTCTGGGG + Intergenic
1152120335 17:78414519-78414541 CTCAGTGGGCAGCTGGGCAGGGG + Intronic
1152339193 17:79715047-79715069 GTCACAGGGCACCTGCTCAGTGG + Intergenic
1152374524 17:79912321-79912343 ATCAGTGGTGACCTTGTAAGAGG - Intergenic
1152770117 17:82162608-82162630 CTCAGAGGGGTCCTGGTCAGTGG - Intronic
1152770133 17:82162666-82162688 CTCAGAGGGGTCCTGGTCAGTGG - Intronic
1152770149 17:82162724-82162746 CTCAGAGGGGTCCTGGTCAGTGG - Intronic
1152770165 17:82162782-82162804 CTCAGAGGGGTCCTGGTCAGTGG - Intronic
1152770181 17:82162840-82162862 CTCAGAGGGGTCCTGGTCAGTGG - Intronic
1152770197 17:82162898-82162920 CTCAGAGGGGTCCTGGTCAGTGG - Intronic
1152869380 17:82743845-82743867 GTCAGGGGAGGCCTGGTCATTGG + Intronic
1154422933 18:14251006-14251028 GTCATTGGAAGCCTGGTCAGTGG + Intergenic
1154422972 18:14251163-14251185 GTCAGTGAGGGCCTGGTCAGAGG + Intergenic
1154422997 18:14251289-14251311 GTCACTGGGGACCAGGTCAGTGG + Intergenic
1154423000 18:14251304-14251326 GTCAGTGGAAAATTGGTCAGTGG + Intergenic
1154423015 18:14251376-14251398 GTCAGTGGGGACTTGATCAGTGG + Intergenic
1154423029 18:14251435-14251457 ATCACTGGGAACCTGGTCAGCGG + Intergenic
1154485759 18:14870562-14870584 GACAGTGGGGTCCTGGTCTTGGG + Intergenic
1156398236 18:36718131-36718153 AACAGTGGGGACCTGGGGAGAGG + Exonic
1158359960 18:56660856-56660878 GTCATTGGTGACCTTGTCAAGGG + Intronic
1160332145 18:78003520-78003542 GACAGTGGGTCCCTGGTAAGGGG + Intergenic
1160425868 18:78778790-78778812 CTCAGTGGGGACCTGTTGTGTGG - Intergenic
1160875688 19:1295361-1295383 GCCAGGGGGGACAGGGTCAGGGG - Intronic
1161591706 19:5131953-5131975 GACAGTGGGGACCGGGTGGGCGG - Exonic
1162726277 19:12691319-12691341 GTGTGTGGGGGCCTGGGCAGGGG - Intronic
1162798957 19:13100814-13100836 GTCAGTGGGGATCTGGGGTGGGG - Intronic
1163232335 19:16013291-16013313 TTCAGTAGGGGCCTGGTCACTGG + Intergenic
1163232341 19:16013306-16013328 GTCACTGGGGGTCTGGTCAGCGG + Intergenic
1163232376 19:16013511-16013533 GTTATTTGGGACCTGGTCAATGG + Intergenic
1163232380 19:16013526-16013548 GTCAATGGGGACGTGTTCTGTGG + Intergenic
1163232405 19:16013630-16013652 CTCAGTGGGGCCCTGGTCAGTGG + Intergenic
1163232689 19:16015230-16015252 GGCAGTTGGGGCCTGGTCAGCGG + Intergenic
1163232707 19:16015287-16015309 AGCAGTTGGGGCCTGGTCAGAGG + Intergenic
1163232788 19:16015603-16015625 GGCAGTTGGGGCCTGGTCATTGG + Intergenic
1163232993 19:16016409-16016431 GTCAGCTAGGACCTGTTCAGTGG + Intergenic
1163236119 19:16031612-16031634 GTCAGTGGGGGCCTTGTCAGTGG + Intergenic
1163236131 19:16031655-16031677 GTCAGCGGGGGTCTGATCAGTGG + Intergenic
1163236140 19:16031699-16031721 GTCAGCTGAGGCCTGGTCAGTGG + Intergenic
1163236170 19:16031828-16031850 GTCAGCGGGGGCCTTGTCAGTGG + Intergenic
1163236180 19:16031871-16031893 GTCAGTGGGGGCCTGATCTGTGG + Intergenic
1163236200 19:16031956-16031978 GTCAATGGGGGCCCGGTCAGCGG + Intergenic
1163236230 19:16032092-16032114 GTCAGCTGTGGCCTGGTCAGAGG + Intergenic
1163236242 19:16032163-16032185 ATCAGTGAGGACCTGGTCAGTGG + Intergenic
1163236246 19:16032178-16032200 GTCAGTGGGCGCCTGGTCAGCGG + Intergenic
1163236258 19:16032237-16032259 GTCTATGGGGACCTAGTCATTGG + Intergenic
1163236299 19:16032429-16032451 GTCAGCGAGGGCCTAGTCAGTGG + Intergenic
1163236307 19:16032458-16032480 GTCAGTAGGGACCTGGGCACTGG + Intergenic
1163236343 19:16032633-16032655 GTCACTGGAGGACTGGTCAGTGG + Intergenic
1163236349 19:16032648-16032670 GTCAGTGGGGACTTGGGTAAGGG + Intergenic
1163236378 19:16032766-16032788 GTCAGTTGGGCCCAAGTCAGTGG + Intergenic
1163236395 19:16032824-16032846 GTCAGTGGAGGTTTGGTCAGTGG + Intergenic
1163236405 19:16032869-16032891 ATCAGTGGGGACCTAGTCAGTGG + Intergenic
1163236520 19:16033354-16033376 GTTAGTGAGGACCTGGTCAGTGG + Intergenic
1163236593 19:16033751-16033773 GTCAGTGGGGGCCTGGTCAGTGG + Intergenic
1163236632 19:16033923-16033945 GTCAGTGAGGGCTTGGTGAGTGG + Intergenic
1163236636 19:16033938-16033960 GTGAGTGGGGGCCTCGTCAGTGG + Intergenic
1163236655 19:16034029-16034051 GTCAGTGCAGCCCTGGCCAGTGG + Intergenic
1163236724 19:16034279-16034301 GTCGGTGGAGACCTGGTCATCGG + Intergenic
1163237842 19:16039665-16039687 GTGAGTGGGGGCCTGGTTAGTGG - Intergenic
1163237848 19:16039680-16039702 GTGGGTGGGGACCTGGTGAGTGG - Intergenic
1163237872 19:16039784-16039806 GTCAGTGGTGGCTTGGTCACTGG - Intergenic
1163237876 19:16039799-16039821 GTCACGGGGGACCGGGTCAGTGG - Intergenic
1163860107 19:19738296-19738318 GTCATTAGGAACCTGGTCAGGGG + Intergenic
1163860179 19:19738704-19738726 GTCAGTGGGGGCCTTGTCATTGG + Intergenic
1163860184 19:19738719-19738741 GTCATTGGGGAACTGGTCAGTGG + Intergenic
1163860191 19:19738748-19738770 GTCAGCAGGGACTGGGTCAGTGG + Intergenic
1163863281 19:19753574-19753596 GTCAGCAGAAACCTGGTCAGAGG - Intergenic
1163863292 19:19753662-19753684 GTCAGTGGAAACATGATCAGTGG - Intergenic
1163863333 19:19753857-19753879 GTCAGTGGGGACCTGGCCAGTGG - Intergenic
1163863338 19:19753872-19753894 ATCTATGGGGACCTGGTCAGTGG - Intergenic
1163863356 19:19753960-19753982 GTGAGTGAGGGCCTGGTCAGTGG - Intergenic
1163863383 19:19754085-19754107 GTGACTTGGGACCTGGTTAGTGG - Intergenic
1163863402 19:19754158-19754180 GTCAGTGTGGACCTGGTCAGTGG - Intergenic
1163863440 19:19754351-19754373 GTCAGTGAGGGTCTGGTCACTGG - Intergenic
1163863485 19:19754570-19754592 GTCAGTGAGGACCTGTTCAGTGG - Intergenic
1163863542 19:19754832-19754854 GTCAGTGAGGGTCTGGTCACTGG - Intergenic
1163863670 19:19755412-19755434 GTCAGTGGAGACGTTGACAGAGG - Intergenic
1163863687 19:19755516-19755538 GTCTGTGGGGGCCTGGTCTTTGG - Intergenic
1163863720 19:19755664-19755686 CTCAGTGGAGGTCTGGTCAGTGG - Intergenic
1163863751 19:19755771-19755793 ATCATTAAGGACCTGGTCAGTGG - Intergenic
1163863766 19:19755830-19755852 GTCAGTGGGGACCTGGCTACTGG - Intergenic
1163863771 19:19755845-19755867 TTCAGTAGGGACCTGGTCAGTGG - Intergenic
1163863792 19:19755933-19755955 GTTATTGGGGTCCTGGTCAGTGG - Intergenic
1163863828 19:19756078-19756100 GTCAGTGAGGACCCGGTCTGCGG - Intergenic
1163863837 19:19756123-19756145 ATCATTGGAGACCTAGTCAGAGG - Intergenic
1163863842 19:19756153-19756175 GTCAGTGGGGGCCTGGTCAATGG - Intergenic
1164017318 19:21264629-21264651 GACAGTGGGCAGCTGGGCAGAGG - Intronic
1164630827 19:29760463-29760485 GAAAGTGGAGACCTAGTCAGGGG - Intergenic
1165852452 19:38857641-38857663 GTCTGAGGGGACAAGGTCAGAGG + Intergenic
1165860715 19:38907802-38907824 GTCAGGAGAGACCTGGACAGGGG + Intronic
1166100416 19:40568260-40568282 ATCAGAGGAGACCTGGTCAAGGG + Exonic
1167035793 19:46994352-46994374 GTCTGTGTGGACCTGGTCACAGG - Intronic
1167446738 19:49542519-49542541 GACAGAGGGGACAAGGTCAGGGG - Intronic
1168632320 19:57967142-57967164 GTCACTAGAGACCTGGGCAGAGG + Intronic
1202634891 1_KI270706v1_random:36336-36358 GGCAGTGGGGGCCTTGTTAGTGG - Intergenic
1202634900 1_KI270706v1_random:36380-36402 GTCAGTAAGGTCCTGGTCAGTGG - Intergenic
1202634962 1_KI270706v1_random:36712-36734 GTCAGAGAGGACTTGGTCAGTGG - Intergenic
1202634981 1_KI270706v1_random:36785-36807 ATCAGTGAGGCCCTTGTCAGTGG - Intergenic
1202635045 1_KI270706v1_random:37113-37135 ATCAGTGTGGGCCTGGTCAGTGG - Intergenic
1202636911 1_KI270706v1_random:51018-51040 GTCACCAGGGACCTGGTCAGTGG - Intergenic
1202636938 1_KI270706v1_random:51149-51171 GTCAGTAAGGTCCTCGTCAGTGG - Intergenic
1202637051 1_KI270706v1_random:51747-51769 ATCAGTGTGGGCCTGCTCAGTGG - Intergenic
1202639541 1_KI270706v1_random:69691-69713 ATCACTGGGAACCTGGTCAGGGG - Intergenic
1202639557 1_KI270706v1_random:69757-69779 GTCAGTGGGGACTTGATCAGTGG - Intergenic
1202639574 1_KI270706v1_random:69829-69851 GTCAGTGGAAAATTGGTCAGTGG - Intergenic
1202639577 1_KI270706v1_random:69844-69866 GTCAATGGGGACCAGGTCAGTGG - Intergenic
1202639605 1_KI270706v1_random:69970-69992 GTCAGTGAGGGCCTGGTCAGAGG - Intergenic
1202650174 1_KI270706v1_random:172992-173014 ATCAGTGTGGGCCTGGTCAGTGG + Intergenic
1202650242 1_KI270706v1_random:173320-173342 ATCAGTGAGGTCCTTGTCAGTGG + Intergenic
1202650259 1_KI270706v1_random:173393-173415 GTCAGAGAGGACTTGGTCAGTGG + Intergenic
1202650319 1_KI270706v1_random:173725-173747 GTCAGTAAGGTCCTGGTCAGTGG + Intergenic
1202650327 1_KI270706v1_random:173769-173791 GGCAGTGGGGCCCTTGTTAGTGG + Intergenic
1202650561 1_KI270707v1_random:265-287 ATCAGTGAGGTCCTTGTCAGTGG + Intergenic
1202650578 1_KI270707v1_random:338-360 GTCAGAGAGGACTTGGTCAGTGG + Intergenic
1202650638 1_KI270707v1_random:670-692 GTCAGTAAGGTCCTGGTCAGTGG + Intergenic
1202650646 1_KI270707v1_random:714-736 GGCAGTGGGGCCCTTGTTAGTGG + Intergenic
925212979 2:2066645-2066667 ATGAGAGGTGACCTGGTCAGGGG + Intronic
926023468 2:9517642-9517664 GTCAGAGGGGTCCAGGACAGAGG + Intronic
929809856 2:45180467-45180489 GTCTGTGGAGACCCAGTCAGAGG - Intergenic
930378987 2:50603352-50603374 GGCTGTGGGGACGTGGGCAGAGG + Intronic
931544664 2:63369437-63369459 GTGAGTGAGGACCTGGGTAGAGG - Intronic
934491291 2:94763313-94763335 GTCAGCAGGGACCTGGTCAGTGG - Intergenic
934491313 2:94763400-94763422 GGCAGCGGGGGCCTGGTTAGTGG - Intergenic
934491409 2:94763921-94763943 GTCAGAGAGGACTTGATCAGTGG - Intergenic
934491492 2:94764311-94764333 ATCAGTGTGGGCCTGCTCAGTGG - Intergenic
934495027 2:94789145-94789167 ATCAGTGGGAACCTGGTCCTGGG - Intergenic
934495039 2:94789204-94789226 GTCAGTGGGGACTTGGTCAGTGG - Intergenic
934495055 2:94789291-94789313 GTCAGTGGGGACCAGGTCAGTGG - Intergenic
934495060 2:94789306-94789328 GTCAGTGGGAACCTGGTCAGTGG - Intergenic
934495082 2:94789411-94789433 GTCAGTGAGGGCCTGGTCAGAGG - Intergenic
934495110 2:94789551-94789573 GTCCATGGGGACCTGGTCAGTGG - Intergenic
938055035 2:128208403-128208425 GACAGTGGGCAGCTGGGCAGAGG - Intergenic
938055162 2:128208993-128209015 GACAGTGGGCAGCTGGGCAGAGG - Intergenic
938279192 2:130052461-130052483 GTCAGCAGGAACCTGGTCAGTGG - Intergenic
938279222 2:130052592-130052614 GTCAGTAAGGTCCTGGTCAGTGG - Intergenic
938279355 2:130053313-130053335 GTTAGTAGGGGCCTGATCAGTGG - Intergenic
938279390 2:130053458-130053480 GTCAGTGATGACTTGGTCAGTGG - Intergenic
938279426 2:130053618-130053640 GTCACTGGTGACCAGGTCAAGGG - Intergenic
938279487 2:130053873-130053895 ATCAGTGTGGGCCTGCTCAGTGG - Intergenic
938330178 2:130443337-130443359 GTCAGCAGGAACCTGGTCAGTGG - Intergenic
938330206 2:130443468-130443490 GTCAGTAAGGTCCTGGTCAGTGG - Intergenic
938330305 2:130444027-130444049 GTTAGTAGGGGCCTGATCAGTGG - Intergenic
938330339 2:130444172-130444194 GTCAGTGATGACTTGGTCAGTGG - Intergenic
938330359 2:130444245-130444267 ATCAGTGAGGCCCTTGTCAGTGG - Intergenic
938330374 2:130444332-130444354 GTCACTGGTGACCAGGTCAAGGG - Intergenic
938330395 2:130444416-130444438 GTCAGTGCAGACCTGGGCTGTGG - Intergenic
938330435 2:130444587-130444609 ATCAGTGTGGGCCTGCTCAGTGG - Intergenic
938359510 2:130676916-130676938 ATCAGTGTGGGCCTGCTCAGTGG + Intergenic
938359550 2:130677087-130677109 GTCAGTGCAGACCTGGGCTGTGG + Intergenic
938359571 2:130677171-130677193 GTCACTGGTGACCAGGTCAAGGG + Intergenic
938359587 2:130677258-130677280 ATCAGTGAGGCCCTTGTCAGTGG + Intergenic
938359607 2:130677331-130677353 GTCAGTGATGACTTGGTCAGTGG + Intergenic
938359640 2:130677476-130677498 GTTAGTAGGGGCCTGATCAGTGG + Intergenic
938359739 2:130678035-130678057 GTCAGTAAGGTCCTGGTCAGTGG + Intergenic
938359767 2:130678166-130678188 GTCAGCAGGAACCTGGTCAGTGG + Intergenic
938407424 2:131040214-131040236 GTGACTGGGGACCCGGTCGGGGG + Intronic
938435909 2:131283562-131283584 ATCAGTGTGGGCCTGCTCAGTGG + Intronic
938435949 2:131283733-131283755 GTCAGTGCAGACCTGGGCTGTGG + Intronic
938435970 2:131283817-131283839 GTCACTGGTGACCAGGTCAAGGG + Intronic
938436004 2:131283977-131283999 GTCAGTGATGACTTGGTCAGTGG + Intronic
938436037 2:131284122-131284144 GTTAGTAGGGGCCTGATCAGTGG + Intronic
938436149 2:131284756-131284778 GTCAGTAAGGTCCTGGTCAGTGG + Intronic
938436177 2:131284887-131284909 GTCAGCAGGAACCTGGTCAGTGG + Intronic
940972270 2:159906726-159906748 GGCAGAGGGGATCAGGTCAGTGG - Intergenic
942248334 2:174026839-174026861 TTCACTGGGGCCCAGGTCAGAGG + Intergenic
945048147 2:205799839-205799861 ATCATTGGGGAACTTGTCAGAGG + Intergenic
948533833 2:238631675-238631697 GGCAGTGGGCACCTGGTGGGAGG - Intergenic
948597547 2:239089986-239090008 GTCAGTCGGGGCCTGGACAGTGG - Intronic
1170154174 20:13254562-13254584 CTCAGTGGTGACTTGGTCACAGG + Intronic
1171459217 20:25289155-25289177 GCGAGTGGGAAGCTGGTCAGAGG + Intronic
1171811818 20:29750579-29750601 TTCAGTGGGGACCTTGTGTGTGG + Intergenic
1171881049 20:30617521-30617543 GGCAGTGGGGGCCTTGTTAGTGG - Intergenic
1171881058 20:30617565-30617587 GTCAGTAAGGTCCTGGTCAGTGG - Intergenic
1171881118 20:30617897-30617919 GTCAGAGAGGACTTTGTCAGTGG - Intergenic
1171881201 20:30618295-30618317 ATCATTGTGGGCCTGGTCAGTGG - Intergenic
1171883038 20:30631948-30631970 CTCAGCAGGGACCTGGTCAGTGG - Intergenic
1171883103 20:30632281-30632303 CTCATTAGGGTCCTGGTCAGGGG - Intergenic
1171883122 20:30632382-30632404 GTCAGAGAGGACTTGATCAGTGG - Intergenic
1171883201 20:30632770-30632792 ATCAGTGTGGGCCTGCTCAGTGG - Intergenic
1171886207 20:30654046-30654068 ATTACTGGGAACCTGGTCAGGGG - Intergenic
1171886223 20:30654112-30654134 GTCAGTGGGGACTTGATCAGTGG - Intergenic
1171886243 20:30654199-30654221 GTCAGTGGGGACCAGCTCAGTGG - Intergenic
1171886269 20:30654325-30654347 GTCAGTGAGGGCCTGGTCAGAGG - Intergenic
1171886305 20:30654482-30654504 GTCATTGGAAGCCTGGTCAGTGG - Intergenic
1171907852 20:30915129-30915151 TTCAGTGGGGACCTTGTGGGTGG - Intergenic
1172436951 20:34935754-34935776 CACAGTGGGAGCCTGGTCAGGGG + Intronic
1173528414 20:43750186-43750208 GACAGTGGGGTGCTGGTCAGGGG + Intergenic
1175088907 20:56485579-56485601 GTGAGTGGGGAAGAGGTCAGTGG + Intronic
1175156381 20:56974495-56974517 GGCAGTGGGGAGCTGTTCCGGGG - Intergenic
1175491724 20:59384510-59384532 GTGAGTGGGGAAGTGGTGAGAGG + Intergenic
1175991752 20:62793369-62793391 TCCAGTGGGAACCTGGGCAGGGG - Intergenic
1176099149 20:63357065-63357087 TTCTGTGGGGACGTGGTCCGTGG - Intronic
1176099184 20:63357206-63357228 TCCTGTGGGGACATGGTCAGTGG - Intronic
1176099191 20:63357236-63357258 GTCTGTGGGGACGTGGTCTGTGG - Intronic
1176109452 20:63404808-63404830 GGCAGTGGGAGCCTGGACAGTGG + Intergenic
1176553077 21:8238540-8238562 TTCAGTGGGGACCTTGTGGGTGG - Intergenic
1176571999 21:8421564-8421586 TTCAGTGGGGACCTTGTGGGTGG - Intergenic
1176579908 21:8466147-8466169 TTCAGTGGGGACCTTGTGGGTGG - Intergenic
1176601485 21:8798796-8798818 GGCAGTGGGGGCCTTGTTAGTGG - Intergenic
1176601494 21:8798840-8798862 GTCAGTAAGGTCCTGGTCGGTGG - Intergenic
1176601554 21:8799158-8799180 GTCAGAGACGACTTGGTCAGTGG - Intergenic
1176601571 21:8799231-8799253 ATCAGTGAGGCCCTTGTCAGTGG - Intergenic
1176601639 21:8799559-8799581 ATCAGTGTGGGCCTGGTCAGTGG - Intergenic
1176626397 21:9095498-9095520 ATCAGTGAGGCCCTTGTCAGTGG + Intergenic
1176626415 21:9095571-9095593 ATCAGAGAGGACTTGGTCAGTGG + Intergenic
1176626478 21:9095889-9095911 GTCAGTAAGGTCCTGGTCGGTGG + Intergenic
1176626488 21:9095933-9095955 GGCAGTGGGGGCCTTGTTAGTGG + Intergenic
1176647105 21:9362105-9362127 GGCAGTGGGGGCCTTGTTAGTGG - Intergenic
1176647115 21:9362149-9362171 GTCAGTAAGGTCCTGGTCAGTGG - Intergenic
1176647173 21:9362480-9362502 GTCAGAGAGGACTTGGTCAGTGG - Intergenic
1176647192 21:9362553-9362575 ATCAGTGAGGCCCTTGTCAGTGG - Intergenic
1176647261 21:9362882-9362904 ATCAGTGTGGGCCTGGTCCGTGG - Intergenic
1176647871 21:9367290-9367312 ATCACTGGGAACCTGGTCAGGGG - Intergenic
1176647886 21:9367356-9367378 GTCAGTGGGGACTTGATCAGTGG - Intergenic
1176647903 21:9367428-9367450 GTCAGTGGAAAATTGGTCAGTGG - Intergenic
1176647906 21:9367443-9367465 GTCAATGGGGACCAGGTCAGTGG - Intergenic
1176647931 21:9367569-9367591 GTCAGTGAGGGCCTGGTCAGAGG - Intergenic
1176647965 21:9367726-9367748 GTCACTGGAAGCCTGGTCAGTGG - Intergenic
1176795570 21:13368907-13368929 GACAGTGGGGTCCTGGTCTTGGG - Intergenic
1176842284 21:13850707-13850729 GTCAGCAGGGACCTGTTCAGTGG - Intergenic
1176850430 21:13908513-13908535 ATCACTGGGAACCTGGTCAGCGG - Intergenic
1176850444 21:13908572-13908594 GTCAGTGGGGACTTGATCAGTGG - Intergenic
1176850460 21:13908644-13908666 GTCAGTGGAAAATTGGTCAGTGG - Intergenic
1176850463 21:13908659-13908681 GTCACTGGGGACCAGGTCAGTGG - Intergenic
1176850489 21:13908785-13908807 GTCAGTGAGGGCCTGGTCAGAGG - Intergenic
1176850526 21:13908942-13908964 GTCATTGGAAGCCTGGTCAGTGG - Intergenic
1179613497 21:42566996-42567018 CTCAGCGGAGCCCTGGTCAGTGG + Exonic
1179802385 21:43817051-43817073 GACAGTGGGCACCTGCTGAGCGG - Intergenic
1180258710 21:46651427-46651449 GGCAGTGGGGACATGGCCTGGGG + Intronic
1180314060 22:11262235-11262257 TTCAGTGGGGACCTTGTGGGTGG + Intergenic
1180341297 22:11621299-11621321 TTCAGTGGGGACCTTGTGGGTGG - Intergenic
1180343770 22:11690333-11690355 GGCAGTGGGGGCCTTGTTAGTGG - Intergenic
1180343781 22:11690377-11690399 GTCAGTAAGGTCCTGGTCAGTGG - Intergenic
1180343839 22:11690709-11690731 GTCAGAGACGACTTGGTCAGTGG - Intergenic
1180343856 22:11690782-11690804 ATCAGTGAGGCCCTTGTCAGTGG - Intergenic
1180343924 22:11691110-11691132 ATCAGTGTGGGCCTGGTCAGTGG - Intergenic
1180362337 22:11911900-11911922 GTCAGTGAGGGCCTGGTCAGAGG + Intergenic
1180362365 22:11912026-11912048 GTCAATGGGGACCAGGTCAGTGG + Intergenic
1180362368 22:11912041-11912063 GTCAGTGGAAAATTGGTCAGTGG + Intergenic
1180362384 22:11912113-11912135 GTCAGTGGGGACTTGATCAGTGG + Intergenic
1180362400 22:11912179-11912201 ATCACTGGGAACCTGGTCAGGGG + Intergenic
1180365660 22:11936114-11936136 ATCAGTGTGGGCCTGGTCAGTGG + Intergenic
1180365727 22:11936443-11936465 ATCAGTGAGGCCCTTGTCAGTGG + Intergenic
1180365746 22:11936516-11936538 GTCAGAGAGGACTTGGTCAGTGG + Intergenic
1180365811 22:11936848-11936870 GTCAGTAAGGTCCTGGTCGGTGG + Intergenic
1180365820 22:11936892-11936914 GGCAGTGGGGGCCTTGTTAGTGG + Intergenic
1180416913 22:12776349-12776371 ATCAGTGAGGCCCTTGTCAGTGG + Intergenic
1180416931 22:12776422-12776444 GTCAGAGAGGACTTGGTCAGTGG + Intergenic
1180416994 22:12776754-12776776 GTCAGTAAGGTCCTGGTCAGTGG + Intergenic
1180417003 22:12776798-12776820 GGCAGTGGGGGCCTTGTTAGTGG + Intergenic
1181001669 22:19990625-19990647 GTCAGTGGTGGCATGGGCAGTGG - Exonic
1181322691 22:22020562-22020584 CTCAGTGGGGACAGGGTCAGAGG + Intergenic
1181531688 22:23520985-23521007 GTCAGTGGGGACCGGCTCCGTGG - Intergenic
1183475056 22:38031566-38031588 GCTGGTGGGGACCTGGACAGCGG - Intronic
1184344533 22:43905091-43905113 GGCACTGGCCACCTGGTCAGAGG + Intergenic
1184728137 22:46357946-46357968 GTCAGTGCTGCCCTGGCCAGGGG + Intergenic
1185215750 22:49599124-49599146 GTGAGTGGGGCCCTTGTTAGTGG + Intronic
1185296661 22:50058149-50058171 CTCACCGGGGACCGGGTCAGTGG + Intergenic
1185337552 22:50277506-50277528 GTGAGTTGGGACCTTGTCTGGGG - Intronic
1203258075 22_KI270733v1_random:155582-155604 TTCAGTGGGGACCTTGTGGGTGG - Intergenic
951855425 3:27191321-27191343 CCCAGTGGCGACCTGGTAAGGGG - Intronic
953432871 3:42854149-42854171 CTCTGTGGGGGCCTGATCAGGGG + Intronic
954108105 3:48419955-48419977 GTCAGTGGGGGCAGGGACAGCGG + Exonic
954457985 3:50610361-50610383 GTGAGTGTGTACCTGGGCAGGGG + Exonic
955236238 3:57142445-57142467 GTCAGTGGAGAGCAGGTTAGTGG - Intronic
957206478 3:77205270-77205292 CTCAGTGGGGAGCTGGGCGGGGG + Intronic
958084874 3:88794710-88794732 GTCAGGGAGGACCTGGTGGGAGG - Intergenic
961072794 3:123951345-123951367 CTCAGAGGGGACATGTTCAGAGG - Intronic
962276993 3:134022869-134022891 AACTGTGGGGACCTGGACAGTGG - Intronic
963601273 3:147380885-147380907 GTGATTGGGGACCTGGTCCACGG - Intergenic
963793208 3:149605130-149605152 GAGAGTGGAGACCTGGTCACAGG + Intronic
965320997 3:167251067-167251089 GTCAGTGGCCTGCTGGTCAGTGG - Intronic
968350320 3:198047508-198047530 GTTAGCAGGGGCCTGGTCAGTGG - Intergenic
968350440 3:198048074-198048096 ATCAGCGTGGGCCTGGTCAGTGG - Intergenic
1202738920 3_GL000221v1_random:37261-37283 GTCATTGGAAGCCTGGTCAGTGG + Intergenic
1202738954 3_GL000221v1_random:37418-37440 GTCAGTGAGGGCCTGGTCAGAGG + Intergenic
1202738979 3_GL000221v1_random:37544-37566 GTCAATGGGGACCAGGTCAGTGG + Intergenic
1202738982 3_GL000221v1_random:37559-37581 GTCAGTGGAAAATTGGTCAGTGG + Intergenic
1202738999 3_GL000221v1_random:37631-37653 GTCAGTGGGGACTTGATCAGTGG + Intergenic
1202739014 3_GL000221v1_random:37697-37719 ATCACTGGGAACCTGGTCAGGGG + Intergenic
1202739619 3_GL000221v1_random:42110-42132 ATCAGTGTGGGCCTGGTCAGTGG + Intergenic
1202739686 3_GL000221v1_random:42439-42461 ATCAGTGAGGCCCTTGTCAGTGG + Intergenic
1202739705 3_GL000221v1_random:42512-42534 GTCAGAGAGGACTTGGTCCGTGG + Intergenic
1202739767 3_GL000221v1_random:42843-42865 GTCAGTAAGGTCCTGGTCGGTGG + Intergenic
1202739776 3_GL000221v1_random:42887-42909 GGCAGTGGGGGCCTTGTGAGTGG + Intergenic
968612665 4:1564202-1564224 GCCAGTGGGGATCTGAGCAGGGG + Intergenic
968667964 4:1831581-1831603 GTCAGTGGAGACCAGGTGGGGGG - Intronic
969369571 4:6723179-6723201 GCCAATGGGGCCCTGGCCAGAGG + Intergenic
969570232 4:8004087-8004109 GTGGGTGGGGACCAGGGCAGAGG - Intronic
969980386 4:11148893-11148915 GTCAGTGTGCCCCTGCTCAGGGG + Intergenic
973364805 4:49200588-49200610 GGCAGTGGGGGCCTTGTTAGTGG - Intergenic
973364814 4:49200632-49200654 GTCAGTAAGGTCCTGGTCAGTGG - Intergenic
973364878 4:49200964-49200986 GTCAGAGAGGACTTGGTCAGTGG - Intergenic
973364964 4:49201366-49201388 ATCAGTGTGGGCCTGGTCAGTGG - Intergenic
973366699 4:49214264-49214286 CTCAGCAGGGACCTGGTCAGTGG - Intergenic
973366724 4:49214395-49214417 GTCAGTAAGGTCCTCGTCAGTGG - Intergenic
973366784 4:49214698-49214720 GTCAGAGAGGACTTGATCAGTGG - Intergenic
973366864 4:49215087-49215109 ATCAGTGTGGGCCTGCTCAGTGG - Intergenic
973369806 4:49236110-49236132 GTCAGCGGGGACTTGATCAGTGG - Intergenic
973369822 4:49236182-49236204 GTCAGTGGAAAATTGGTCAGTGG - Intergenic
973369825 4:49236197-49236219 GTCAGTGGGGACCAGGTCAGTGG - Intergenic
973369854 4:49236323-49236345 GTCAATGAGGGCCTGGTCAGAGG - Intergenic
973391178 4:49559089-49559111 GTCAATGAGGGCCTGGTCAGAGG + Intergenic
973391207 4:49559215-49559237 GTCAGTGGGGACCAGGTCAGTGG + Intergenic
973391210 4:49559230-49559252 GTCAGTGGAAAATTGGTCAGTGG + Intergenic
973391226 4:49559302-49559324 GTCAGCGGGGACTTGATCAGTGG + Intergenic
973393754 4:49577318-49577340 ATCAGTGTGGGCCTGCTCAGTGG + Intergenic
973393867 4:49577916-49577938 GTCAGTAAGGTCCTCGTCAGTGG + Intergenic
973393894 4:49578047-49578069 GTCACCAGGGACCTGGTCAATGG + Intergenic
973395628 4:49591084-49591106 ATCAGTGTGGGCCTGGTCAGTGG + Intergenic
973395695 4:49591413-49591435 ATCAGTGAGGCCCTTGTCAGTGG + Intergenic
973395713 4:49591486-49591508 GTCAGAGAGGACTTGGTCAGTGG + Intergenic
973395776 4:49591818-49591840 GTCAGTAAGGTCCTGGTCAGTGG + Intergenic
973395785 4:49591862-49591884 GGCAGTGGGGGCCTTGTTAGTGG + Intergenic
978491625 4:109316755-109316777 GTCAGAGGGGACCAGGGCACTGG + Intergenic
981459489 4:144996464-144996486 GTCAGTTGGGACCTTCCCAGGGG - Intronic
981487535 4:145302781-145302803 ATCACTGGGGGCCAGGTCAGAGG - Intergenic
983058800 4:163130963-163130985 GTCAGCTGGGACCCGGGCAGCGG - Intronic
984713009 4:182901947-182901969 GGCAGTGGGGGCCGGGGCAGGGG - Intronic
984866418 4:184284199-184284221 GTCAGAGGGGACCTGGTGGCGGG - Intergenic
1202762199 4_GL000008v2_random:122244-122266 GGCAGTGGGGGCCTTGTTAGTGG - Intergenic
1202762208 4_GL000008v2_random:122288-122310 GTCAGTAAGGTCCTGGTCAGTGG - Intergenic
1202762270 4_GL000008v2_random:122620-122642 GTCAGAGAGGACTTGGTCAGTGG - Intergenic
1202762280 4_GL000008v2_random:122664-122686 ATCAGTGAGGCCCTTGTCAGTGG - Intergenic
1202762346 4_GL000008v2_random:122993-123015 ATCAGTGTGGGCCTGGTCAGTGG - Intergenic
1202764226 4_GL000008v2_random:136889-136911 GTCACCAGGGACCTGGTCAGTGG - Intergenic
1202764252 4_GL000008v2_random:137020-137042 GTCAGTAAGGTCCTCGTCAGTGG - Intergenic
1202764365 4_GL000008v2_random:137604-137626 ATCAGTGTGGGCCTGCTCAGGGG - Intergenic
1202766901 4_GL000008v2_random:155546-155568 ATCACTGGGAACCTGGTCAGGGG - Intergenic
1202766916 4_GL000008v2_random:155612-155634 GTCAGTGGGGACTTGATCAGTGG - Intergenic
1202766933 4_GL000008v2_random:155684-155706 GTCAGTGGAAAATTGGTCAGTGG - Intergenic
1202766936 4_GL000008v2_random:155699-155721 GTCAATGGGGACCAGGTCAGTGG - Intergenic
1202766961 4_GL000008v2_random:155825-155847 GTCAGTGAGGGCCTGGTCAGAGG - Intergenic
1202766995 4_GL000008v2_random:155982-156004 GTCATTGGAAGCCTGGTCAGTGG - Intergenic
985767074 5:1785807-1785829 CTCAGTGGGGAACTGGGAAGAGG - Intergenic
986293427 5:6418234-6418256 GACAGTGGGGACCTGGAAGGGGG + Intergenic
988580025 5:32460742-32460764 GTCAGGGGGAACCTGGTGGGAGG - Intergenic
991509871 5:67364728-67364750 GCCAGTGGAGACCTGGTCTCAGG + Intergenic
992208778 5:74456836-74456858 GTCGGGGGGGACCTGGTGGGAGG - Intergenic
995850248 5:116537433-116537455 GTCTGTGGAGACCAGGTCAGGGG + Intronic
996716181 5:126589867-126589889 GACAGTGGGCAGCTGGGCAGAGG - Intronic
996716205 5:126589985-126590007 GACAGTGGGCAGCTGGGCAGAGG - Intronic
998352857 5:141512481-141512503 CGCACTGGGGACCTGGGCAGTGG - Exonic
999046152 5:148472033-148472055 GCCAGTGGGAAACTGGTGAGTGG - Intronic
1000046435 5:157525558-157525580 GTCAGTGGGGGTGAGGTCAGGGG - Intronic
1000154357 5:158535989-158536011 GTCAGTGGGTAGAAGGTCAGAGG - Intergenic
1001359820 5:171071477-171071499 GCCAGTGGGGTCCTGGCCAAAGG + Intronic
1001589454 5:172855483-172855505 GACAGTGGGGACCATGTCTGTGG - Intronic
1001928330 5:175655570-175655592 GCCAGTGGGAACCTGATCGGGGG - Intergenic
1001980034 5:176031570-176031592 GACAGTGGGGTCCTGGTCTTGGG - Intronic
1002237348 5:177812093-177812115 GACAGTGGGGTCCTGGTCTTGGG + Intergenic
1002276082 5:178105111-178105133 GACAGTGGGGTCCTGGTCTTGGG - Intergenic
1002376165 5:178790535-178790557 GCCAGTGGCGACCAGGGCAGTGG + Intergenic
1002861944 6:1087151-1087173 GTCATTTGGGACCTGGTTAAAGG + Intergenic
1002947491 6:1776965-1776987 GTAGGTGGGGATCTGGCCAGAGG + Intronic
1004145134 6:13058880-13058902 ATCAGTGGGGAGCTGGTCTTTGG - Intronic
1006335064 6:33416107-33416129 GTGAATGGGGAGCTGGGCAGAGG - Exonic
1007027090 6:38587232-38587254 GTCAGTGGAGACCTGTGGAGAGG + Intronic
1007415800 6:41690640-41690662 GTGAGTGAGGAGCTGGCCAGTGG - Intronic
1007904720 6:45448131-45448153 GTGAGTGGGGAGGAGGTCAGAGG + Intronic
1013820123 6:114144918-114144940 GTTAGTTGGGACCTGAACAGTGG + Intronic
1014129033 6:117810459-117810481 GTCAGGAGGCACCGGGTCAGGGG + Intergenic
1014276755 6:119397428-119397450 GTCAGAGGGGACCAGGGCACTGG - Intergenic
1015719396 6:136225728-136225750 GTGGGGGGGGACCTGGTGAGAGG - Intergenic
1015731169 6:136349748-136349770 GTCAGTGGGGAACCTGTCAGGGG + Intronic
1016205653 6:141465669-141465691 GTCAGTGTGGACCATGTCATTGG - Intergenic
1017979363 6:159386095-159386117 GTCAGGGGCGCCCTGGGCAGTGG + Intergenic
1018175064 6:161171482-161171504 GTCAGTGGGTTCCTGCTAAGTGG - Intronic
1018503126 6:164434039-164434061 GTCAGGGAGAACCTGGCCAGAGG + Intergenic
1018673381 6:166197941-166197963 GAGAGTGGGGATCTGGTCAGTGG - Intergenic
1019690854 7:2410811-2410833 ATCAGTGGAGTCCTGGTCACGGG + Intronic
1026217283 7:68360925-68360947 TTCATTGGGAACCTAGTCAGTGG - Intergenic
1026848495 7:73710763-73710785 GTCAGTGCTGAGCTAGTCAGTGG - Intronic
1027059510 7:75074098-75074120 GTTTGAGGGGACCTGGGCAGGGG - Intronic
1027186166 7:75972036-75972058 GGCCGTGGGGACCTGGGCTGTGG + Intronic
1029544559 7:101203377-101203399 CTCAGTGAGGACCTGGGCTGTGG - Intergenic
1030777464 7:113552242-113552264 GCCAGTGGGGACCCTATCAGGGG + Intergenic
1030871874 7:114765422-114765444 GGAAGTGAGCACCTGGTCAGAGG + Intergenic
1032418352 7:131756221-131756243 GACAGTGGGCAGCTGGGCAGAGG + Intergenic
1032839552 7:135703329-135703351 GCCAGTGAGAACATGGTCAGGGG - Intronic
1032892022 7:136207198-136207220 GTTTTTGGGGACCTGGTGAGAGG + Intergenic
1035311842 7:157974619-157974641 GGCAGTGGGAGCCTGGGCAGGGG + Intronic
1036206905 8:6812101-6812123 CTCTGGGGGGACCTGCTCAGGGG + Exonic
1037118696 8:15257026-15257048 CTCAGTGGTGATCTGGTCAGAGG - Intergenic
1038397979 8:27261228-27261250 GGCAGTGGGGTGCAGGTCAGGGG - Intergenic
1038939750 8:32291352-32291374 GTCAGAGGGTTCCAGGTCAGTGG - Intronic
1039326994 8:36496540-36496562 GTCTGCGAGGACCTGGACAGTGG + Intergenic
1040101571 8:43511395-43511417 GTTAGTGGTGACCTGGTCAGTGG + Intergenic
1040101603 8:43511529-43511551 GTCAGTGGGAGCCTAGTCAGGGG + Intergenic
1040101624 8:43511633-43511655 CTCAGTGGGGGCCTGGTCAGAGG + Intergenic
1040101645 8:43511719-43511741 GCCAGTGGGTACTTGGTCAATGG + Intergenic
1040101650 8:43511734-43511756 GTCAATGGGGACCTGGTAAATGG + Intergenic
1040104624 8:43534720-43534742 GTCAGCAGGGGCCTGGTCAGTGG + Intergenic
1040104630 8:43534735-43534757 GTCAGTGGGACTGTGGTCAGGGG + Intergenic
1040104640 8:43534794-43534816 GTTAGGGGGAACCTGGTCAGTGG + Intergenic
1040104654 8:43534852-43534874 GTCAGTGAGGACCTGGTGAGCGG + Intergenic
1040104658 8:43534867-43534889 GTGAGCGGAGGCCTGGTCAGTGG + Intergenic
1040104671 8:43534910-43534932 TTCAGTGGGGACCTGCTCAGTGG + Intergenic
1040104689 8:43534998-43535020 GTCAGTGGCAACCTGATCTGTGG + Intergenic
1040104723 8:43535175-43535197 GCCAGTGGGGGCTTGGTAAGAGG + Intergenic
1040104787 8:43535466-43535488 GTCAGAGGGGACTTGGTCAGTGG + Intergenic
1040104792 8:43535511-43535533 ATCAGTGGTGACCTGGTCAGCGG + Intergenic
1040104830 8:43535685-43535707 GTCAGTAAGGACCTGGTCAGTGG + Intergenic
1040104839 8:43535729-43535751 GTCAGTAAGGTCCTGGGCAGTGG + Intergenic
1040104876 8:43535873-43535895 GTCAGCAGGGACCTGGTCAGTGG + Intergenic
1040844194 8:51819397-51819419 GCCAGGGTAGACCTGGTCAGCGG - Exonic
1041296612 8:56363195-56363217 GGCAGTGGGGACCCTCTCAGGGG + Intergenic
1044996304 8:97841063-97841085 GACAGTGGGGAGCTGGGTAGAGG + Intronic
1049345309 8:142135707-142135729 GGGAGTGGGGCTCTGGTCAGCGG - Intergenic
1049354971 8:142183093-142183115 GACAGTGGGGTGCTGGTGAGGGG + Intergenic
1049563295 8:143324241-143324263 CTCAGTGGTGCCGTGGTCAGGGG + Intronic
1049673443 8:143879544-143879566 GTGAGTGTGGACCTGGTGGGTGG - Intergenic
1052876780 9:33573821-33573843 ATCAGCAGGGACCTGGTTAGCGG + Intergenic
1052876799 9:33573905-33573927 GTCAGTGGGGACCTGGTCAGTGG + Intergenic
1052876827 9:33574045-33574067 GTCAGTGAGAGCCTGGTCAGAGG + Intergenic
1052876848 9:33574150-33574172 GTCAGTGGGAACCCAGTCAGTGG + Intergenic
1052876854 9:33574165-33574187 GTCAGTGGGGACCAGGTCAGTGG + Intergenic
1052876858 9:33574180-33574202 GTCAGTGGGAAATTGGTCAGTGG + Intergenic
1052876877 9:33574251-33574273 GTCCGTGGGGACTTGGTCAGTGG + Intergenic
1052880444 9:33598426-33598448 GTCAGTAAGGTCCTGGTCAGTGG + Intergenic
1052880476 9:33598557-33598579 GTCAGCAGGGACCTGGTCAGCGG + Intergenic
1053129795 9:35608476-35608498 GTCAGGGCGGTCCTGGTGAGTGG - Exonic
1053495533 9:38545791-38545813 GTCAGTAAGGTCCTGGTCAGTGG - Intronic
1053495567 9:38545937-38545959 GTTAATAGGGGCCTGGTCAGTGG - Intronic
1053495612 9:38546155-38546177 ATCAGTGAGGCCCTTGTCAGTGG - Intronic
1053499133 9:38570135-38570157 GTCCGTGGGGACTTGGTCAGTGG - Intronic
1053499153 9:38570206-38570228 GTCAGTGGGAAATTGGTCAGTGG - Intronic
1053499157 9:38570221-38570243 GTCAGTGGGGACCAGGTCAGTGG - Intronic
1053499163 9:38570236-38570258 GTCAGTGCGAACCCAGTCAGTGG - Intronic
1053499181 9:38570341-38570363 GTCAGTGAGAGCCTGGTCAGAGG - Intronic
1053499207 9:38570481-38570503 GTCAGTGGGGACCTGGTCAGTGG - Intronic
1053499225 9:38570565-38570587 ATCAGCAGGGACCTGGTTAGTGG - Intronic
1053661990 9:40290724-40290746 GTCAGTTGGGACCTGGTTAGTGG + Intronic
1053662039 9:40290943-40290965 GTCAGTGAGGGTCTGGTCAGAGG + Intronic
1053662060 9:40291048-40291070 GTCAGTGGGAACCTGGTCAGTGG + Intronic
1053662065 9:40291063-40291085 GTCAGTGGGGACCAGGTCAGTGG + Intronic
1053662082 9:40291150-40291172 GTCAGTGGGGACTTGGTCAGTGG + Intronic
1053666558 9:40321794-40321816 GTCACTGGTGACCCGGTCAAGGG + Intronic
1053666591 9:40321950-40321972 GTCAGAGAGGACTTGATCAGTGG + Intronic
1053666621 9:40322094-40322116 GTTAGTAGGGACCTGGTCACTGG + Intronic
1053666626 9:40322124-40322146 TTCCCTGGAGACCTGGTCAGTGG + Intronic
1053666654 9:40322238-40322260 GTCAGTGAGGTCCTTGTCAGTGG + Intronic
1053666687 9:40322369-40322391 GTCAGCAGGGACCTGGTCAGTGG + Intronic
1053912440 9:42920888-42920910 GTCAGTTGGGACCTGGTTAGTGG + Intergenic
1053912488 9:42921111-42921133 GTTAGTGAGGGCCTGGTCAGAGG + Intergenic
1053912509 9:42921216-42921238 GTCAGTGGGAACCTGGTCAGTGG + Intergenic
1053912514 9:42921231-42921253 GTCAGTGGGGACCAGGTCAGTGG + Intergenic
1053912531 9:42921318-42921340 GTCAGTGGGGACTTGGTCAGTGG + Intergenic
1053916142 9:42946840-42946862 GTCACTGGTGACCCGGTCAAGGG + Intergenic
1053916157 9:42946918-42946940 ATCAGTGAGGCCCTTGTCAGTGG + Intergenic
1053916177 9:42946996-42947018 GTCAGAGAGGACTTGATCAGTGG + Intergenic
1053916208 9:42947141-42947163 GTTAGTAGGGGCCTGGTCACTGG + Intergenic
1053916213 9:42947171-42947193 TTCCCTGGAGACCTGGTCAGTGG + Intergenic
1053916283 9:42947459-42947481 GTCAGCAGGGACCTGGTCAGTGG + Intergenic
1054374116 9:64436960-64436982 GTCAGTTGGGACCTGGTTAGTGG + Intergenic
1054374165 9:64437183-64437205 GTCAGTGAGGGCCTGGTCAGAGG + Intergenic
1054374187 9:64437288-64437310 GTCAGTGGGAACCTGGTCAGTGG + Intergenic
1054374192 9:64437303-64437325 GTCAGTGGGGACCAGGTCAGTGG + Intergenic
1054374209 9:64437390-64437412 GTCAGTGGGGACTTGGTCAGTGG + Intergenic
1054377710 9:64461822-64461844 GTCACTGGTGACCCGGTCAAGGG + Intergenic
1054377743 9:64461978-64462000 GTCAGAGAGGACTTGATCAGTGG + Intergenic
1054377773 9:64462122-64462144 GTTAGTAGGGACCTGGTCACTGG + Intergenic
1054377778 9:64462152-64462174 TTCCCTGGAGACCTGGTCAGTGG + Intergenic
1054377837 9:64462397-64462419 GTCAGCAGGGACCTGGTCAGTGG + Intergenic
1054517923 9:66053914-66053936 GTCAGCAGGGACCTGGTCAGTGG - Intergenic
1054517956 9:66054045-66054067 GTCAGTGAGGTCCTTGTCAGTGG - Intergenic
1054517983 9:66054159-66054181 TTCCCTGGAGACCTGGTCAGTGG - Intergenic
1054517988 9:66054189-66054211 GTTAGTAGGGACCTGGTCACTGG - Intergenic
1054518018 9:66054333-66054355 GTCAGAGAGGACTTGATCAGTGG - Intergenic
1054518051 9:66054489-66054511 GTCACTGGTGACCCGGTCAAGGG - Intergenic
1054522528 9:66085134-66085156 GTCAGTGGGGACTTGGTCAGTGG - Intergenic
1054522545 9:66085221-66085243 GTCAGTGGGGACCAGGTCAGTGG - Intergenic
1054522550 9:66085236-66085258 GTCAGTGGGAACCTGGTCAGTGG - Intergenic
1054522570 9:66085341-66085363 GTCAGTGAGGGTCTGGTCAGAGG - Intergenic
1054522619 9:66085560-66085582 GTCAGTTGGGACCTGGTTAGTGG - Intergenic
1055231659 9:74074092-74074114 GACAGTGGGCAGCTGGGCAGAGG + Intergenic
1055985638 9:82055283-82055305 GTCAGCGGGGATCTGAGCAGTGG + Intergenic
1055985709 9:82055560-82055582 GGCAGTGGGGGCCTGGTTAGTGG + Intergenic
1056585610 9:87925472-87925494 GTCAGCAGGGACCTGGTGCGGGG - Intergenic
1056585722 9:87925968-87925990 ATCAGTGAGGCCCTTGTCAGTGG - Intergenic
1056585740 9:87926055-87926077 GTCACTGGTGACCAGGTCAAGGG - Intergenic
1056585790 9:87926310-87926332 ATCAGTGTGGGCCTCGTCAGTGG - Intergenic
1056586688 9:87932044-87932066 GTCAGTGGGGATCTGGTTTGGGG - Intergenic
1056586695 9:87932059-87932081 GTCATTAGGGGCCTTGTCAGTGG - Intergenic
1056586707 9:87932103-87932125 GCCAGTGGGGACTTGGCCAGTGG - Intergenic
1056586728 9:87932180-87932202 ATCAGTGGGAACCCAGTCAGTGG - Intergenic
1056586752 9:87932285-87932307 GTCAGTGAGGGCCTGGTCAGAGG - Intergenic
1056586782 9:87932425-87932447 GTCAGTGGGGACCTGGTCAGTGG - Intergenic
1056610095 9:88120516-88120538 GTCAGTGGGGACCTGGTCAGTGG + Intergenic
1056610126 9:88120656-88120678 GTCAGTGAGGGCCTGGTCAGAGG + Intergenic
1056610150 9:88120761-88120783 GTCAGTGGGAACCCAGTCAGTGG + Intergenic
1056610170 9:88120838-88120860 GCCAGTGGGGACTTGGTCAGTGG + Intergenic
1056610181 9:88120882-88120904 GTCATTAGGGGCCTTGTCAGTGG + Intergenic
1056610188 9:88120897-88120919 GTCAGTGGGGACCTGGTTTGGGG + Intergenic
1056611092 9:88126633-88126655 ATCAGTGTGGGCCTCGTCAGTGG + Intergenic
1056611140 9:88126889-88126911 GTCACTGGTGACCAGGTCAATGG + Intergenic
1056611157 9:88126976-88126998 ATCAGTGAGGCCCTTGTCAGTGG + Intergenic
1056611269 9:88127472-88127494 GTCAGCAGGGACCTGGTGCGGGG + Intergenic
1057162176 9:92896448-92896470 GTCATTAGGGGCCTTGTCAGTGG - Intergenic
1057162187 9:92896492-92896514 GTCAGTGGGGACTTGGCCAGTGG - Intergenic
1057162208 9:92896569-92896591 GTCAGTGGGAACCCAGTCAGTGG - Intergenic
1057162231 9:92896674-92896696 GTCAGTGATGGCCTGGTCAGAGG - Intergenic
1057162260 9:92896814-92896836 GTCAGTGGGGACCTGGTCAGTGG - Intergenic
1057675389 9:97133012-97133034 GTCAGCAGGGACCTGGTCAGTGG - Intergenic
1057675424 9:97133143-97133165 GTCAGTAAGGTCCTGGTCAGTGG - Intergenic
1057675432 9:97133172-97133194 GTTAGTAAGGACCTTGTCAGTGG - Intergenic
1057675539 9:97133671-97133693 ATCAGTGAGGCCCTTGTCAGTGG - Intergenic
1057675556 9:97133758-97133780 GTCACTGGTGACCAGGTCAAGGG - Intergenic
1057678559 9:97154616-97154638 GTCAGTGGAGACTTGATCAGTGG - Intergenic
1057678576 9:97154688-97154710 GTCAGTGAGAAATTGGTCAGTGG - Intergenic
1057678582 9:97154718-97154740 GTCAGTGGGAACTCAGTCAGTGG - Intergenic
1057678601 9:97154823-97154845 GTCATTGAGGGTCTGGTCAGAGG - Intergenic
1057678628 9:97154963-97154985 GTCAGTGGGGACCTGGTCAGTGG - Intergenic
1057678643 9:97155046-97155068 ATCAGCAGGGACCTGGTTAGCGG - Intergenic
1058104656 9:100956380-100956402 CTCAGTAGGGACCTGGTAAGAGG - Intergenic
1060193179 9:121605883-121605905 GTCTGTGGGGACCATGTCTGTGG - Intronic
1060525717 9:124320247-124320269 CTCTGGGGGGACCTGGTGAGAGG + Intronic
1062004279 9:134231517-134231539 GGCAGTGGGGGCTTGGACAGAGG + Intergenic
1062543216 9:137050689-137050711 CTCAGAGGGAGCCTGGTCAGGGG - Intronic
1203749508 Un_GL000218v1:65584-65606 ATCAGTGTGGGCCTGGTCAGTGG + Intergenic
1203749573 Un_GL000218v1:65912-65934 ATCAGTGAGGCCCTTGTCAGTGG + Intergenic
1203749591 Un_GL000218v1:65985-66007 GTCAGAGAGGACTTGGTCAGTGG + Intergenic
1203749650 Un_GL000218v1:66303-66325 GTCAGTAAGGTCCTGGTCGGTGG + Intergenic
1203749660 Un_GL000218v1:66347-66369 GGCAGTGGGGGCCTTGTGAGTGG + Intergenic
1203474269 Un_GL000220v1:137605-137627 TTCAGTGGGGACCTTGTGGGTGG - Intergenic
1203362372 Un_KI270442v1:228354-228376 TTCAGTGGGGACCTTGTGGGTGG + Intergenic
1203707648 Un_KI270742v1:67705-67727 GTCATTGGAAGCCTGGTCAGTGG + Intergenic
1203707682 Un_KI270742v1:67862-67884 GTCAGTGAGGGCCTGGTCAGAGG + Intergenic
1203707707 Un_KI270742v1:67988-68010 GTCAATGGGGACCAGGTCAGTGG + Intergenic
1203707710 Un_KI270742v1:68003-68025 GTCAGTGGAAAATTGGTCAGTGG + Intergenic
1203707727 Un_KI270742v1:68075-68097 GTCAGTGGGGACTTGATCAGTGG + Intergenic
1203707742 Un_KI270742v1:68141-68163 ATCACTGGGAACCTGGTCAGGGG + Intergenic
1203708265 Un_KI270742v1:72067-72089 ATCAGTGTGGGCCTGGTCAGTGG + Intergenic
1203708331 Un_KI270742v1:72396-72418 ATCAGTGAGGCCCTTGTCAGTGG + Intergenic
1203708350 Un_KI270742v1:72469-72491 GTCAGAGAGGACTTGGTCAGTGG + Intergenic
1203708411 Un_KI270742v1:72800-72822 GTCAGTAAGGTCCTGGTCAGTGG + Intergenic
1203542964 Un_KI270743v1:107125-107147 GGCAGTGGGGGCCTTGTTAGTGG - Intergenic
1203542973 Un_KI270743v1:107169-107191 GTCAGTAAGGTCCTGGTCAGTGG - Intergenic
1203543034 Un_KI270743v1:107501-107523 GTCAGAGAGGACTTGGTCAGTGG - Intergenic
1203543044 Un_KI270743v1:107545-107567 ATCAGTGAGGCCCTTGTCAGTGG - Intergenic
1203543109 Un_KI270743v1:107874-107896 ATCAGTGTGGGCCTGGTCAGTGG - Intergenic
1203544974 Un_KI270743v1:121762-121784 GTCACCAGGGACCTGGTCAGTGG - Intergenic
1203545116 Un_KI270743v1:122491-122513 ATCAGTGTGGGCCTGCTCAGGGG - Intergenic
1203547650 Un_KI270743v1:140423-140445 ATCACTGGGAACCTGGTCAGGGG - Intergenic
1203547666 Un_KI270743v1:140489-140511 GTCAGTGGGGACTTGATCAGTGG - Intergenic
1203547682 Un_KI270743v1:140561-140583 GTCAGTGGAAAATTGGTCAGTGG - Intergenic
1203547685 Un_KI270743v1:140576-140598 GTCAATGGGGACCAGGTCAGTGG - Intergenic
1203547713 Un_KI270743v1:140702-140724 GTCAGTGAAGGCCTGGTCAGAGG - Intergenic
1203547746 Un_KI270743v1:140859-140881 GTCATTGGAAGCCTGGTCAGTGG - Intergenic
1185619193 X:1442955-1442977 GTCAGAGGGGAGATGGTCAGAGG - Intronic
1188765753 X:34088939-34088961 GTCAGAGGGGACCAGGGCATTGG + Intergenic
1189226849 X:39420238-39420260 GTCACTGGGGGCAAGGTCAGGGG + Intergenic
1190006083 X:46739516-46739538 GGCTGTTGGGACCTGGTCGGAGG - Intronic
1190153201 X:47965777-47965799 GACAGTGGGCAGCTGGGCAGAGG - Intronic
1190619316 X:52269568-52269590 TTTAGTGGGGACCTGGGAAGGGG + Intergenic
1193101727 X:77622267-77622289 GTCAGAGGGGATCTGGTAAATGG + Intronic
1194412870 X:93578130-93578152 CACTTTGGGGACCTGGTCAGTGG + Intergenic
1195094856 X:101493090-101493112 GGCACTGGGGACCAGGCCAGTGG + Exonic
1195254743 X:103080810-103080832 TTCAGTGGGGACTTGGACAAAGG - Intronic
1195978881 X:110558024-110558046 GACAGTGGGCAGCTGGGCAGAGG + Intergenic
1199070547 X:143470226-143470248 TTGTGTGGGGACCTGGTAAGAGG - Intergenic
1199950190 X:152700396-152700418 GGCAGTGAGGACTTGGTCTGAGG + Intronic
1199959486 X:152768065-152768087 GGCAGTGAGGACTTGGTCTGAGG - Intronic
1201075873 Y:10187902-10187924 TTCAGTGGGGACCTTGTGAGTGG - Intergenic
1201162871 Y:11180598-11180620 ATCAGGGTGGGCCTGGTCAGTGG + Intergenic
1201162938 Y:11180927-11180949 ATCAGTGAGGCCCTTGTCAGTGG + Intergenic
1201162956 Y:11181000-11181022 GTCAGAGAGGACTCGGTCAGTGG + Intergenic
1201163019 Y:11181318-11181340 GTCAGTAAGGTCCTGGTCGGTGG + Intergenic