ID: 1056610096

View in Genome Browser
Species Human (GRCh38)
Location 9:88120519-88120541
Sequence AGTGGGGACCTGGTCAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056610087_1056610096 17 Left 1056610087 9:88120479-88120501 CCAGTAGGGATCTGGTGACCTAG No data
Right 1056610096 9:88120519-88120541 AGTGGGGACCTGGTCAGTGGTGG No data
1056610086_1056610096 22 Left 1056610086 9:88120474-88120496 CCTCACCAGTAGGGATCTGGTGA No data
Right 1056610096 9:88120519-88120541 AGTGGGGACCTGGTCAGTGGTGG No data
1056610089_1056610096 -1 Left 1056610089 9:88120497-88120519 CCTAGTCATTGGAAGCCTAGTCA No data
Right 1056610096 9:88120519-88120541 AGTGGGGACCTGGTCAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056610096 Original CRISPR AGTGGGGACCTGGTCAGTGG TGG Intergenic
No off target data available for this crispr