ID: 1056610099

View in Genome Browser
Species Human (GRCh38)
Location 9:88120532-88120554
Sequence TCAGTGGTGGCCTTATTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056610087_1056610099 30 Left 1056610087 9:88120479-88120501 CCAGTAGGGATCTGGTGACCTAG No data
Right 1056610099 9:88120532-88120554 TCAGTGGTGGCCTTATTAGTGGG No data
1056610089_1056610099 12 Left 1056610089 9:88120497-88120519 CCTAGTCATTGGAAGCCTAGTCA No data
Right 1056610099 9:88120532-88120554 TCAGTGGTGGCCTTATTAGTGGG No data
1056610094_1056610099 -3 Left 1056610094 9:88120512-88120534 CCTAGTCAGTGGGGACCTGGTCA No data
Right 1056610099 9:88120532-88120554 TCAGTGGTGGCCTTATTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056610099 Original CRISPR TCAGTGGTGGCCTTATTAGT GGG Intergenic
No off target data available for this crispr