ID: 1056611030

View in Genome Browser
Species Human (GRCh38)
Location 9:88126264-88126286
Sequence CTGTAGCCTTTCCATACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056611026_1056611030 4 Left 1056611026 9:88126237-88126259 CCCATGGGCTGGGCTGGTGTGGA No data
Right 1056611030 9:88126264-88126286 CTGTAGCCTTTCCATACTGAGGG No data
1056611021_1056611030 15 Left 1056611021 9:88126226-88126248 CCATGGCTGCTCCCATGGGCTGG No data
Right 1056611030 9:88126264-88126286 CTGTAGCCTTTCCATACTGAGGG No data
1056611019_1056611030 17 Left 1056611019 9:88126224-88126246 CCCCATGGCTGCTCCCATGGGCT No data
Right 1056611030 9:88126264-88126286 CTGTAGCCTTTCCATACTGAGGG No data
1056611027_1056611030 3 Left 1056611027 9:88126238-88126260 CCATGGGCTGGGCTGGTGTGGAG No data
Right 1056611030 9:88126264-88126286 CTGTAGCCTTTCCATACTGAGGG No data
1056611018_1056611030 18 Left 1056611018 9:88126223-88126245 CCCCCATGGCTGCTCCCATGGGC No data
Right 1056611030 9:88126264-88126286 CTGTAGCCTTTCCATACTGAGGG No data
1056611020_1056611030 16 Left 1056611020 9:88126225-88126247 CCCATGGCTGCTCCCATGGGCTG No data
Right 1056611030 9:88126264-88126286 CTGTAGCCTTTCCATACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056611030 Original CRISPR CTGTAGCCTTTCCATACTGA GGG Intergenic
No off target data available for this crispr