ID: 1056611839

View in Genome Browser
Species Human (GRCh38)
Location 9:88130733-88130755
Sequence CAGCTGGACAGGAGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056611839_1056611848 14 Left 1056611839 9:88130733-88130755 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1056611848 9:88130770-88130792 GACCCATGATCATTCGAAGATGG No data
1056611839_1056611845 -8 Left 1056611839 9:88130733-88130755 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1056611845 9:88130748-88130770 TCCAGCTGTAGGAGCCTTCAAGG No data
1056611839_1056611853 27 Left 1056611839 9:88130733-88130755 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1056611853 9:88130783-88130805 TCGAAGATGGGATCCCTCGCGGG No data
1056611839_1056611854 28 Left 1056611839 9:88130733-88130755 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1056611854 9:88130784-88130806 CGAAGATGGGATCCCTCGCGGGG No data
1056611839_1056611852 26 Left 1056611839 9:88130733-88130755 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1056611852 9:88130782-88130804 TTCGAAGATGGGATCCCTCGCGG No data
1056611839_1056611849 15 Left 1056611839 9:88130733-88130755 CCACCTGCCCTCCTGTCCAGCTG No data
Right 1056611849 9:88130771-88130793 ACCCATGATCATTCGAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056611839 Original CRISPR CAGCTGGACAGGAGGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr