ID: 1056612885

View in Genome Browser
Species Human (GRCh38)
Location 9:88136445-88136467
Sequence CTGATAAACCATATCTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056612885_1056612889 26 Left 1056612885 9:88136445-88136467 CCTTGTCAGATATGGTTTATCAG No data
Right 1056612889 9:88136494-88136516 TTTACCCTGTCTTTATTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056612885 Original CRISPR CTGATAAACCATATCTGACA AGG (reversed) Intergenic
No off target data available for this crispr