ID: 1056613385

View in Genome Browser
Species Human (GRCh38)
Location 9:88139935-88139957
Sequence CTGATAAACCGTATCTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056613385_1056613389 28 Left 1056613385 9:88139935-88139957 CCTTGTCAGATACGGTTTATCAG No data
Right 1056613389 9:88139986-88140008 TACCCTGTCTTTTTATTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056613385 Original CRISPR CTGATAAACCGTATCTGACA AGG (reversed) Intergenic
No off target data available for this crispr