ID: 1056617430

View in Genome Browser
Species Human (GRCh38)
Location 9:88180504-88180526
Sequence AGCCAGGGGTTCGGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056617430_1056617449 8 Left 1056617430 9:88180504-88180526 CCTGCTGCCCCGAACCCCTGGCT No data
Right 1056617449 9:88180535-88180557 CAATGAGGGGGCAGTGGAAGGGG No data
1056617430_1056617442 -6 Left 1056617430 9:88180504-88180526 CCTGCTGCCCCGAACCCCTGGCT No data
Right 1056617442 9:88180521-88180543 CTGGCTCCAGGGGGCAATGAGGG No data
1056617430_1056617450 21 Left 1056617430 9:88180504-88180526 CCTGCTGCCCCGAACCCCTGGCT No data
Right 1056617450 9:88180548-88180570 GTGGAAGGGGCACTACTCCTCGG No data
1056617430_1056617448 7 Left 1056617430 9:88180504-88180526 CCTGCTGCCCCGAACCCCTGGCT No data
Right 1056617448 9:88180534-88180556 GCAATGAGGGGGCAGTGGAAGGG No data
1056617430_1056617446 2 Left 1056617430 9:88180504-88180526 CCTGCTGCCCCGAACCCCTGGCT No data
Right 1056617446 9:88180529-88180551 AGGGGGCAATGAGGGGGCAGTGG No data
1056617430_1056617441 -7 Left 1056617430 9:88180504-88180526 CCTGCTGCCCCGAACCCCTGGCT No data
Right 1056617441 9:88180520-88180542 CCTGGCTCCAGGGGGCAATGAGG No data
1056617430_1056617444 -4 Left 1056617430 9:88180504-88180526 CCTGCTGCCCCGAACCCCTGGCT No data
Right 1056617444 9:88180523-88180545 GGCTCCAGGGGGCAATGAGGGGG No data
1056617430_1056617451 22 Left 1056617430 9:88180504-88180526 CCTGCTGCCCCGAACCCCTGGCT No data
Right 1056617451 9:88180549-88180571 TGGAAGGGGCACTACTCCTCGGG No data
1056617430_1056617447 6 Left 1056617430 9:88180504-88180526 CCTGCTGCCCCGAACCCCTGGCT No data
Right 1056617447 9:88180533-88180555 GGCAATGAGGGGGCAGTGGAAGG No data
1056617430_1056617443 -5 Left 1056617430 9:88180504-88180526 CCTGCTGCCCCGAACCCCTGGCT No data
Right 1056617443 9:88180522-88180544 TGGCTCCAGGGGGCAATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056617430 Original CRISPR AGCCAGGGGTTCGGGGCAGC AGG (reversed) Intergenic
No off target data available for this crispr