ID: 1056617440

View in Genome Browser
Species Human (GRCh38)
Location 9:88180520-88180542
Sequence CCTCATTGCCCCCTGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056617440_1056617450 5 Left 1056617440 9:88180520-88180542 CCTGGCTCCAGGGGGCAATGAGG No data
Right 1056617450 9:88180548-88180570 GTGGAAGGGGCACTACTCCTCGG No data
1056617440_1056617447 -10 Left 1056617440 9:88180520-88180542 CCTGGCTCCAGGGGGCAATGAGG No data
Right 1056617447 9:88180533-88180555 GGCAATGAGGGGGCAGTGGAAGG No data
1056617440_1056617448 -9 Left 1056617440 9:88180520-88180542 CCTGGCTCCAGGGGGCAATGAGG No data
Right 1056617448 9:88180534-88180556 GCAATGAGGGGGCAGTGGAAGGG No data
1056617440_1056617449 -8 Left 1056617440 9:88180520-88180542 CCTGGCTCCAGGGGGCAATGAGG No data
Right 1056617449 9:88180535-88180557 CAATGAGGGGGCAGTGGAAGGGG No data
1056617440_1056617451 6 Left 1056617440 9:88180520-88180542 CCTGGCTCCAGGGGGCAATGAGG No data
Right 1056617451 9:88180549-88180571 TGGAAGGGGCACTACTCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056617440 Original CRISPR CCTCATTGCCCCCTGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr