ID: 1056617463

View in Genome Browser
Species Human (GRCh38)
Location 9:88180611-88180633
Sequence GCCCTCCTTCTCTCCCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056617453_1056617463 11 Left 1056617453 9:88180577-88180599 CCTAGAGAAGCGAGACCGTCCCG No data
Right 1056617463 9:88180611-88180633 GCCCTCCTTCTCTCCCGCCCGGG No data
1056617456_1056617463 -8 Left 1056617456 9:88180596-88180618 CCCGCCCTCCCGCTGGCCCTCCT No data
Right 1056617463 9:88180611-88180633 GCCCTCCTTCTCTCCCGCCCGGG No data
1056617457_1056617463 -9 Left 1056617457 9:88180597-88180619 CCGCCCTCCCGCTGGCCCTCCTT No data
Right 1056617463 9:88180611-88180633 GCCCTCCTTCTCTCCCGCCCGGG No data
1056617452_1056617463 23 Left 1056617452 9:88180565-88180587 CCTCGGGCATTGCCTAGAGAAGC No data
Right 1056617463 9:88180611-88180633 GCCCTCCTTCTCTCCCGCCCGGG No data
1056617455_1056617463 -4 Left 1056617455 9:88180592-88180614 CCGTCCCGCCCTCCCGCTGGCCC No data
Right 1056617463 9:88180611-88180633 GCCCTCCTTCTCTCCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056617463 Original CRISPR GCCCTCCTTCTCTCCCGCCC GGG Intergenic
No off target data available for this crispr