ID: 1056618589

View in Genome Browser
Species Human (GRCh38)
Location 9:88190987-88191009
Sequence GTGCTCTGCTCAAGATCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056618584_1056618589 19 Left 1056618584 9:88190945-88190967 CCCCCATCCTCAAAGCGTTTCTT No data
Right 1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG No data
1056618585_1056618589 18 Left 1056618585 9:88190946-88190968 CCCCATCCTCAAAGCGTTTCTTC No data
Right 1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG No data
1056618588_1056618589 12 Left 1056618588 9:88190952-88190974 CCTCAAAGCGTTTCTTCACACAT No data
Right 1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG No data
1056618586_1056618589 17 Left 1056618586 9:88190947-88190969 CCCATCCTCAAAGCGTTTCTTCA No data
Right 1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG No data
1056618587_1056618589 16 Left 1056618587 9:88190948-88190970 CCATCCTCAAAGCGTTTCTTCAC No data
Right 1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056618589 Original CRISPR GTGCTCTGCTCAAGATCCCA TGG Intergenic
No off target data available for this crispr