ID: 1056618663

View in Genome Browser
Species Human (GRCh38)
Location 9:88191445-88191467
Sequence GGGTGAATTAATGCAAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056618658_1056618663 5 Left 1056618658 9:88191417-88191439 CCCACTTTTAATTACATGCAAAA No data
Right 1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG No data
1056618657_1056618663 15 Left 1056618657 9:88191407-88191429 CCTACTTTTACCCACTTTTAATT No data
Right 1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG No data
1056618659_1056618663 4 Left 1056618659 9:88191418-88191440 CCACTTTTAATTACATGCAAAAT No data
Right 1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG No data
1056618656_1056618663 27 Left 1056618656 9:88191395-88191417 CCTGTGTTTCTACCTACTTTTAC No data
Right 1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056618663 Original CRISPR GGGTGAATTAATGCAAATTA AGG Intergenic
No off target data available for this crispr