ID: 1056619165

View in Genome Browser
Species Human (GRCh38)
Location 9:88196145-88196167
Sequence AGCCATGTGAAACCACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056619165_1056619168 17 Left 1056619165 9:88196145-88196167 CCAGGCAGTGGTTTCACATGGCT No data
Right 1056619168 9:88196185-88196207 GAAATAGCTGCAGAAACTATGGG No data
1056619165_1056619167 16 Left 1056619165 9:88196145-88196167 CCAGGCAGTGGTTTCACATGGCT No data
Right 1056619167 9:88196184-88196206 AGAAATAGCTGCAGAAACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056619165 Original CRISPR AGCCATGTGAAACCACTGCC TGG (reversed) Intergenic
No off target data available for this crispr