ID: 1056623548

View in Genome Browser
Species Human (GRCh38)
Location 9:88235388-88235410
Sequence CCTTCTCCCAAGACAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056623544_1056623548 4 Left 1056623544 9:88235361-88235383 CCTCTCTGTGTGTCTTCCCATGA No data
Right 1056623548 9:88235388-88235410 CCTTCTCCCAAGACAGTGTCTGG No data
1056623543_1056623548 28 Left 1056623543 9:88235337-88235359 CCTGTGGCTGATCTCAGACGAGA No data
Right 1056623548 9:88235388-88235410 CCTTCTCCCAAGACAGTGTCTGG No data
1056623542_1056623548 29 Left 1056623542 9:88235336-88235358 CCCTGTGGCTGATCTCAGACGAG No data
Right 1056623548 9:88235388-88235410 CCTTCTCCCAAGACAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056623548 Original CRISPR CCTTCTCCCAAGACAGTGTC TGG Intergenic
No off target data available for this crispr