ID: 1056626840

View in Genome Browser
Species Human (GRCh38)
Location 9:88260729-88260751
Sequence GACGAGGGAATGGCCCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056626828_1056626840 18 Left 1056626828 9:88260688-88260710 CCCGTTAGGCAGAGAGAGTTTGG No data
Right 1056626840 9:88260729-88260751 GACGAGGGAATGGCCCCAGGTGG No data
1056626827_1056626840 23 Left 1056626827 9:88260683-88260705 CCAGACCCGTTAGGCAGAGAGAG No data
Right 1056626840 9:88260729-88260751 GACGAGGGAATGGCCCCAGGTGG No data
1056626830_1056626840 17 Left 1056626830 9:88260689-88260711 CCGTTAGGCAGAGAGAGTTTGGG No data
Right 1056626840 9:88260729-88260751 GACGAGGGAATGGCCCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056626840 Original CRISPR GACGAGGGAATGGCCCCAGG TGG Intergenic
No off target data available for this crispr