ID: 1056627617

View in Genome Browser
Species Human (GRCh38)
Location 9:88266472-88266494
Sequence CTGAAAATGCAAATAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056627616_1056627617 0 Left 1056627616 9:88266449-88266471 CCAGAGATATCAGTAGTGAGAGA No data
Right 1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056627617 Original CRISPR CTGAAAATGCAAATAGACAA TGG Intergenic
No off target data available for this crispr