ID: 1056627617 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:88266472-88266494 |
| Sequence | CTGAAAATGCAAATAGACAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1056627616_1056627617 | 0 | Left | 1056627616 | 9:88266449-88266471 | CCAGAGATATCAGTAGTGAGAGA | No data | ||
| Right | 1056627617 | 9:88266472-88266494 | CTGAAAATGCAAATAGACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1056627617 | Original CRISPR | CTGAAAATGCAAATAGACAA TGG | Intergenic | ||
| No off target data available for this crispr | |||||