ID: 1056630632

View in Genome Browser
Species Human (GRCh38)
Location 9:88290363-88290385
Sequence TGCCAAACTCTGACCAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056630628_1056630632 13 Left 1056630628 9:88290327-88290349 CCATACATTCATGATGCTCATCT No data
Right 1056630632 9:88290363-88290385 TGCCAAACTCTGACCAGGCGTGG No data
1056630627_1056630632 26 Left 1056630627 9:88290314-88290336 CCATTCTACAAGTCCATACATTC No data
Right 1056630632 9:88290363-88290385 TGCCAAACTCTGACCAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056630632 Original CRISPR TGCCAAACTCTGACCAGGCG TGG Intergenic
No off target data available for this crispr