ID: 1056633227

View in Genome Browser
Species Human (GRCh38)
Location 9:88310730-88310752
Sequence CCACCCAACAGGGGTACAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056633227_1056633237 23 Left 1056633227 9:88310730-88310752 CCCATTGTACCCCTGTTGGGTGG No data
Right 1056633237 9:88310776-88310798 AGGCTCACTGCCTTGATGTCAGG No data
1056633227_1056633238 26 Left 1056633227 9:88310730-88310752 CCCATTGTACCCCTGTTGGGTGG No data
Right 1056633238 9:88310779-88310801 CTCACTGCCTTGATGTCAGGAGG No data
1056633227_1056633239 29 Left 1056633227 9:88310730-88310752 CCCATTGTACCCCTGTTGGGTGG No data
Right 1056633239 9:88310782-88310804 ACTGCCTTGATGTCAGGAGGTGG No data
1056633227_1056633234 3 Left 1056633227 9:88310730-88310752 CCCATTGTACCCCTGTTGGGTGG No data
Right 1056633234 9:88310756-88310778 GGCCGCCTAGAGCTGAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056633227 Original CRISPR CCACCCAACAGGGGTACAAT GGG (reversed) Intergenic
No off target data available for this crispr