ID: 1056634203

View in Genome Browser
Species Human (GRCh38)
Location 9:88318201-88318223
Sequence ATTCCTCAAAGCGGCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056634203_1056634210 21 Left 1056634203 9:88318201-88318223 CCTGCAGGGCCGCTTTGAGGAAT No data
Right 1056634210 9:88318245-88318267 CCTTGGCCTCATCACCACCTTGG No data
1056634203_1056634206 4 Left 1056634203 9:88318201-88318223 CCTGCAGGGCCGCTTTGAGGAAT No data
Right 1056634206 9:88318228-88318250 CCTCATGCTTATGAACCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056634203 Original CRISPR ATTCCTCAAAGCGGCCCTGC AGG (reversed) Intergenic
No off target data available for this crispr