ID: 1056637571

View in Genome Browser
Species Human (GRCh38)
Location 9:88344370-88344392
Sequence ATGGATCAGAACCACCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056637569_1056637571 -8 Left 1056637569 9:88344355-88344377 CCAAACCATATTGGTATGGATCA No data
Right 1056637571 9:88344370-88344392 ATGGATCAGAACCACCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056637571 Original CRISPR ATGGATCAGAACCACCCTCT TGG Intergenic
No off target data available for this crispr