ID: 1056644534

View in Genome Browser
Species Human (GRCh38)
Location 9:88399330-88399352
Sequence GCCTGACAGAAACCGCTTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056644534_1056644537 19 Left 1056644534 9:88399330-88399352 CCGTTAAGCGGTTTCTGTCAGGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1056644537 9:88399372-88399394 GCTGGAGTTTGAAGTCCACAGGG No data
1056644534_1056644536 18 Left 1056644534 9:88399330-88399352 CCGTTAAGCGGTTTCTGTCAGGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1056644536 9:88399371-88399393 TGCTGGAGTTTGAAGTCCACAGG No data
1056644534_1056644535 1 Left 1056644534 9:88399330-88399352 CCGTTAAGCGGTTTCTGTCAGGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1056644535 9:88399354-88399376 GTTGTCTTTGTGATTGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056644534 Original CRISPR GCCTGACAGAAACCGCTTAA CGG (reversed) Intronic
914989817 1:152489194-152489216 GCCTTACAGAAAATGCTCAAGGG - Intergenic
918906722 1:190505797-190505819 GGCTGACAGACACCTCATAAAGG - Intergenic
924023057 1:239804836-239804858 GCCGGACAGAGACAGATTAAGGG - Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1065581416 10:27175479-27175501 GCCTAACTGAAACTTCTTAATGG + Intronic
1067045009 10:42980606-42980628 GACTGACAGAAACCGCATGGTGG + Intergenic
1067759506 10:49033473-49033495 TCCTGACAGAGACCACTTAGAGG + Intronic
1068000318 10:51325819-51325841 GCCTGACAGCAACCTCCTCAGGG + Intronic
1075433467 10:122411249-122411271 GCCTGAGAGAAACCTCTTCAAGG + Intronic
1079108500 11:17589735-17589757 GCCTGACCGAAAGGGCTTAAAGG - Intronic
1090560448 11:127926670-127926692 GCCTGACGGAAAGTGCTGAAAGG + Intergenic
1093337406 12:17922813-17922835 GCCTAACAGGAAACGCTCAAAGG + Intergenic
1096289153 12:50326212-50326234 GCCTCACAGAAAAAGGTTAAAGG - Intronic
1097301526 12:58024239-58024261 GCCTGAAAGACACTGCTTATTGG + Intergenic
1121803942 14:96797782-96797804 GCCTGACAGAACCGGCTTCCCGG - Intronic
1124701297 15:31914851-31914873 GCCAGACAGATACCCCTCAAAGG - Intergenic
1133177088 16:4023611-4023633 GCCAGGCAGAAACCTCTTAATGG - Intronic
1135577238 16:23595441-23595463 GCCTTGCAGAATCCGCTTATAGG + Intronic
1138583441 16:57956183-57956205 GCCTGGCAGCCACAGCTTAAAGG - Intronic
1141836911 16:86546805-86546827 GCATTCCAGAAACCGCTTTAGGG + Intronic
1143555655 17:7658201-7658223 GCCTGACAGACAGCGGTTGACGG - Intergenic
1149428101 17:56574730-56574752 GCTTGATGGAAACCCCTTAAGGG - Intergenic
1150189487 17:63223129-63223151 GCATGATAGTAACTGCTTAATGG + Intronic
1153338026 18:3944622-3944644 GACTGACAGATACCGCTTCTAGG + Intronic
1166248370 19:41547127-41547149 GCCTGACAGACAGCTCTCAAGGG + Intergenic
1167582927 19:50357190-50357212 GCCTCTCAGAAACTACTTAAGGG - Intronic
928308165 2:30188333-30188355 CCCTGACAGTAACAACTTAATGG + Intergenic
935660678 2:105464249-105464271 GCCTGACAGATACCATTGAAGGG + Intergenic
939345464 2:140960938-140960960 GCCTGACATTAACCTATTAATGG + Intronic
1173656573 20:44703920-44703942 TCCTCACAGAAACCCCCTAAAGG - Intergenic
1174045499 20:47729895-47729917 TCCTGAATGAAACCGCTTTAGGG + Intronic
1174399716 20:50269526-50269548 GACTGACAGAGCCCGCATAAAGG - Intergenic
1178519172 21:33272915-33272937 CCCCGACAGCAACCGCTAAAGGG - Intronic
955524145 3:59803742-59803764 GCCTGAACGAAACAGCCTAAGGG + Intronic
958957770 3:100479964-100479986 GGCTGACAGACACCTCATAAAGG - Intergenic
960763239 3:121096761-121096783 GGCTGACAGAAACCTCATACAGG - Intronic
969084022 4:4641895-4641917 GCCTGAAAGAAACTGGTTAAAGG - Intergenic
970620842 4:17816420-17816442 GCCTGAGAGAATCTGCTTATAGG + Intronic
975002646 4:69244568-69244590 GGCTGACAGAAACCTCATAAAGG - Intergenic
975010754 4:69348556-69348578 GGCTGACAGAAACCTCATAAAGG - Intronic
975082080 4:70293849-70293871 GCCTAACAGAAACTGTTAAAGGG - Intergenic
977841822 4:101716063-101716085 GCCTGACAAGAAATGCTTAAGGG + Intronic
981512742 4:145575069-145575091 GGCTGACAGAAACCTCATATAGG + Intergenic
984732200 4:183078628-183078650 GCCTGAAAGAAACTGCCTGAGGG + Intergenic
986049451 5:4075087-4075109 GCCTTACAGACACAGCTGAAAGG - Intergenic
990229370 5:53694915-53694937 GCCTTACAAAAAATGCTTAATGG + Intergenic
991445365 5:66694307-66694329 GGCTGCCAGAAACCACTGAAAGG - Intronic
993840619 5:92874418-92874440 GCCTTACAAAAAGTGCTTAAGGG - Intergenic
999355496 5:150926707-150926729 GCCTTAAAGAAACTGCTAAAGGG - Intergenic
1003220441 6:4156476-4156498 TCCTTTCAGAAACCACTTAAAGG - Intergenic
1003647559 6:7926431-7926453 GCCTGACAGATACCTCATATAGG + Intronic
1007203341 6:40129796-40129818 ACCTGACAGCAACAACTTAAGGG + Intergenic
1007990331 6:46248557-46248579 TCCAGACAGAAACAGCTTAGTGG - Intronic
1010576403 6:77537140-77537162 GCTTCTCAGAAACAGCTTAATGG + Intergenic
1013926596 6:115480474-115480496 GGCTGACAGACACCTCTTACAGG - Intergenic
1015893434 6:137992305-137992327 GTATGACAAAAACCGCTTACAGG + Intergenic
1018634217 6:165846670-165846692 TCCTTCCACAAACCGCTTAAAGG - Intronic
1019036102 6:169060812-169060834 GCCTTACAGGAAATGCTTAAGGG - Intergenic
1037567514 8:20130216-20130238 GCCTGACAGACACAGCTCAGAGG + Intergenic
1038207919 8:25486353-25486375 CCCTGGCGGAAACCCCTTAATGG + Intronic
1038707468 8:29908204-29908226 GCTTGACAAAAACTGCTTAAGGG + Intergenic
1043266742 8:78276052-78276074 GACTGGCAGAAACAGCTTAGTGG - Intergenic
1052695043 9:31867625-31867647 GCCTTACAAAAAATGCTTAAGGG - Intergenic
1056020668 9:82435062-82435084 GCCTGACAAGAAATGCTTAAGGG - Intergenic
1056644534 9:88399330-88399352 GCCTGACAGAAACCGCTTAACGG - Intronic
1062510225 9:136901278-136901300 CCCAGAGAGAAACCTCTTAAAGG - Intronic
1189053494 X:37672229-37672251 GCCTGCCAGAAAATACTTAATGG - Intronic
1189569188 X:42276960-42276982 GCAAGACAGAAACAGCTTAGGGG - Intergenic
1190588109 X:51967575-51967597 GCCTGGCAGAAACCCCTATAGGG - Intergenic
1195141501 X:101965074-101965096 GCCTGACAGGCACCCCTTACAGG + Intergenic
1197459641 X:126724321-126724343 GTTTAACAGAAGCCGCTTAATGG + Intergenic