ID: 1056646207

View in Genome Browser
Species Human (GRCh38)
Location 9:88414060-88414082
Sequence GCCCTATATGTCACTTCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056646207_1056646211 24 Left 1056646207 9:88414060-88414082 CCATAAGAAGTGACATATAGGGC No data
Right 1056646211 9:88414107-88414129 GAAGTGTTCATGCCCTCCTGTGG No data
1056646207_1056646210 -9 Left 1056646207 9:88414060-88414082 CCATAAGAAGTGACATATAGGGC No data
Right 1056646210 9:88414074-88414096 ATATAGGGCAGTGTCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056646207 Original CRISPR GCCCTATATGTCACTTCTTA TGG (reversed) Intronic