ID: 1056646208

View in Genome Browser
Species Human (GRCh38)
Location 9:88414069-88414091
Sequence GTGACATATAGGGCAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056646204_1056646208 -10 Left 1056646204 9:88414056-88414078 CCAACCATAAGAAGTGACATATA No data
Right 1056646208 9:88414069-88414091 GTGACATATAGGGCAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056646208 Original CRISPR GTGACATATAGGGCAGTGTC TGG Intronic