ID: 1056646209

View in Genome Browser
Species Human (GRCh38)
Location 9:88414070-88414092
Sequence TGACATATAGGGCAGTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056646204_1056646209 -9 Left 1056646204 9:88414056-88414078 CCAACCATAAGAAGTGACATATA No data
Right 1056646209 9:88414070-88414092 TGACATATAGGGCAGTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056646209 Original CRISPR TGACATATAGGGCAGTGTCT GGG Intronic