ID: 1056646210

View in Genome Browser
Species Human (GRCh38)
Location 9:88414074-88414096
Sequence ATATAGGGCAGTGTCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056646207_1056646210 -9 Left 1056646207 9:88414060-88414082 CCATAAGAAGTGACATATAGGGC No data
Right 1056646210 9:88414074-88414096 ATATAGGGCAGTGTCTGGGAAGG No data
1056646204_1056646210 -5 Left 1056646204 9:88414056-88414078 CCAACCATAAGAAGTGACATATA No data
Right 1056646210 9:88414074-88414096 ATATAGGGCAGTGTCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056646210 Original CRISPR ATATAGGGCAGTGTCTGGGA AGG Intronic