ID: 1056653688

View in Genome Browser
Species Human (GRCh38)
Location 9:88491314-88491336
Sequence TCATTTGTACTGATGCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056653688_1056653690 29 Left 1056653688 9:88491314-88491336 CCTTCAGGCATCAGTACAAATGA No data
Right 1056653690 9:88491366-88491388 AGTCACTTTTAGATGACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056653688 Original CRISPR TCATTTGTACTGATGCCTGA AGG (reversed) Intergenic
No off target data available for this crispr