ID: 1056657637

View in Genome Browser
Species Human (GRCh38)
Location 9:88522394-88522416
Sequence ATGGGCTGGCCAGGATAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056657637_1056657653 29 Left 1056657637 9:88522394-88522416 CCCCTTTATCCTGGCCAGCCCAT No data
Right 1056657653 9:88522446-88522468 CACGCAGCTGTGTGGCTCTGCGG No data
1056657637_1056657645 -2 Left 1056657637 9:88522394-88522416 CCCCTTTATCCTGGCCAGCCCAT No data
Right 1056657645 9:88522415-88522437 ATGAGATCCTCCCTCTGGAAAGG No data
1056657637_1056657652 21 Left 1056657637 9:88522394-88522416 CCCCTTTATCCTGGCCAGCCCAT No data
Right 1056657652 9:88522438-88522460 GACAGGGTCACGCAGCTGTGTGG No data
1056657637_1056657642 -7 Left 1056657637 9:88522394-88522416 CCCCTTTATCCTGGCCAGCCCAT No data
Right 1056657642 9:88522410-88522432 AGCCCATGAGATCCTCCCTCTGG No data
1056657637_1056657646 -1 Left 1056657637 9:88522394-88522416 CCCCTTTATCCTGGCCAGCCCAT No data
Right 1056657646 9:88522416-88522438 TGAGATCCTCCCTCTGGAAAGGG No data
1056657637_1056657649 5 Left 1056657637 9:88522394-88522416 CCCCTTTATCCTGGCCAGCCCAT No data
Right 1056657649 9:88522422-88522444 CCTCCCTCTGGAAAGGGACAGGG No data
1056657637_1056657647 4 Left 1056657637 9:88522394-88522416 CCCCTTTATCCTGGCCAGCCCAT No data
Right 1056657647 9:88522421-88522443 TCCTCCCTCTGGAAAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056657637 Original CRISPR ATGGGCTGGCCAGGATAAAG GGG (reversed) Intergenic
No off target data available for this crispr