ID: 1056658249

View in Genome Browser
Species Human (GRCh38)
Location 9:88526351-88526373
Sequence CTCCTAGGAAACCCCCATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056658242_1056658249 1 Left 1056658242 9:88526327-88526349 CCCTACCTGGGCCGTGGGGTTTA No data
Right 1056658249 9:88526351-88526373 CTCCTAGGAAACCCCCATAGGGG No data
1056658244_1056658249 -4 Left 1056658244 9:88526332-88526354 CCTGGGCCGTGGGGTTTATCTCC No data
Right 1056658249 9:88526351-88526373 CTCCTAGGAAACCCCCATAGGGG No data
1056658235_1056658249 24 Left 1056658235 9:88526304-88526326 CCCATACAGTCTGTTCTGTCGTG No data
Right 1056658249 9:88526351-88526373 CTCCTAGGAAACCCCCATAGGGG No data
1056658243_1056658249 0 Left 1056658243 9:88526328-88526350 CCTACCTGGGCCGTGGGGTTTAT No data
Right 1056658249 9:88526351-88526373 CTCCTAGGAAACCCCCATAGGGG No data
1056658234_1056658249 25 Left 1056658234 9:88526303-88526325 CCCCATACAGTCTGTTCTGTCGT No data
Right 1056658249 9:88526351-88526373 CTCCTAGGAAACCCCCATAGGGG No data
1056658246_1056658249 -10 Left 1056658246 9:88526338-88526360 CCGTGGGGTTTATCTCCTAGGAA No data
Right 1056658249 9:88526351-88526373 CTCCTAGGAAACCCCCATAGGGG No data
1056658236_1056658249 23 Left 1056658236 9:88526305-88526327 CCATACAGTCTGTTCTGTCGTGC No data
Right 1056658249 9:88526351-88526373 CTCCTAGGAAACCCCCATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056658249 Original CRISPR CTCCTAGGAAACCCCCATAG GGG Intergenic
No off target data available for this crispr