ID: 1056660005

View in Genome Browser
Species Human (GRCh38)
Location 9:88536232-88536254
Sequence CCCACAGTGCAGGCCGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056660000_1056660005 6 Left 1056660000 9:88536203-88536225 CCGCGAGGACATCAGCTCTGTGA 0: 1
1: 0
2: 4
3: 15
4: 185
Right 1056660005 9:88536232-88536254 CCCACAGTGCAGGCCGTGGTTGG No data
1056659999_1056660005 7 Left 1056659999 9:88536202-88536224 CCCGCGAGGACATCAGCTCTGTG 0: 1
1: 0
2: 0
3: 21
4: 151
Right 1056660005 9:88536232-88536254 CCCACAGTGCAGGCCGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056660005 Original CRISPR CCCACAGTGCAGGCCGTGGT TGG Intronic
No off target data available for this crispr