ID: 1056662704

View in Genome Browser
Species Human (GRCh38)
Location 9:88556248-88556270
Sequence TGTCACATGGGGAGGCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056662696_1056662704 17 Left 1056662696 9:88556208-88556230 CCAGGAATATGTTTCAGCTCGTT 0: 1
1: 0
2: 2
3: 18
4: 120
Right 1056662704 9:88556248-88556270 TGTCACATGGGGAGGCCACCTGG No data
1056662695_1056662704 21 Left 1056662695 9:88556204-88556226 CCAGCCAGGAATATGTTTCAGCT 0: 1
1: 2
2: 8
3: 24
4: 172
Right 1056662704 9:88556248-88556270 TGTCACATGGGGAGGCCACCTGG No data
1056662698_1056662704 -9 Left 1056662698 9:88556234-88556256 CCACTGCTGCTTCCTGTCACATG 0: 1
1: 2
2: 10
3: 44
4: 378
Right 1056662704 9:88556248-88556270 TGTCACATGGGGAGGCCACCTGG No data
1056662697_1056662704 -8 Left 1056662697 9:88556233-88556255 CCCACTGCTGCTTCCTGTCACAT 0: 1
1: 2
2: 8
3: 37
4: 337
Right 1056662704 9:88556248-88556270 TGTCACATGGGGAGGCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056662704 Original CRISPR TGTCACATGGGGAGGCCACC TGG Intronic
No off target data available for this crispr