ID: 1056674073

View in Genome Browser
Species Human (GRCh38)
Location 9:88658418-88658440
Sequence CAGAATCGTTTATTATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056674073_1056674077 17 Left 1056674073 9:88658418-88658440 CCTGGAGATAATAAACGATTCTG No data
Right 1056674077 9:88658458-88658480 TTAGTTATTGCTCAAAACCTGGG No data
1056674073_1056674078 27 Left 1056674073 9:88658418-88658440 CCTGGAGATAATAAACGATTCTG No data
Right 1056674078 9:88658468-88658490 CTCAAAACCTGGGTTTTCAATGG No data
1056674073_1056674074 -9 Left 1056674073 9:88658418-88658440 CCTGGAGATAATAAACGATTCTG No data
Right 1056674074 9:88658432-88658454 ACGATTCTGTCATACGCTCTAGG No data
1056674073_1056674076 16 Left 1056674073 9:88658418-88658440 CCTGGAGATAATAAACGATTCTG No data
Right 1056674076 9:88658457-88658479 CTTAGTTATTGCTCAAAACCTGG No data
1056674073_1056674075 -8 Left 1056674073 9:88658418-88658440 CCTGGAGATAATAAACGATTCTG No data
Right 1056674075 9:88658433-88658455 CGATTCTGTCATACGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056674073 Original CRISPR CAGAATCGTTTATTATCTCC AGG (reversed) Intergenic