ID: 1056674078

View in Genome Browser
Species Human (GRCh38)
Location 9:88658468-88658490
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056674073_1056674078 27 Left 1056674073 9:88658418-88658440 CCTGGAGATAATAAACGATTCTG No data
Right 1056674078 9:88658468-88658490 CTCAAAACCTGGGTTTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056674078 Original CRISPR CTCAAAACCTGGGTTTTCAA TGG Intergenic
No off target data available for this crispr