ID: 1056674112

View in Genome Browser
Species Human (GRCh38)
Location 9:88658716-88658738
Sequence CAGTGTGTGAGCAGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056674107_1056674112 -7 Left 1056674107 9:88658700-88658722 CCTGGGCGGCCAACCTCAGTGTG No data
Right 1056674112 9:88658716-88658738 CAGTGTGTGAGCAGGGAAAATGG No data
1056674106_1056674112 1 Left 1056674106 9:88658692-88658714 CCTTTTGACCTGGGCGGCCAACC No data
Right 1056674112 9:88658716-88658738 CAGTGTGTGAGCAGGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056674112 Original CRISPR CAGTGTGTGAGCAGGGAAAA TGG Intergenic
No off target data available for this crispr