ID: 1056674608

View in Genome Browser
Species Human (GRCh38)
Location 9:88664577-88664599
Sequence TGGGATTTGTTGGGAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056674608_1056674614 12 Left 1056674608 9:88664577-88664599 CCAGTCTTTCCCAACAAATCCCA No data
Right 1056674614 9:88664612-88664634 ACAAAAAGACGTCCACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056674608 Original CRISPR TGGGATTTGTTGGGAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr