ID: 1056676145

View in Genome Browser
Species Human (GRCh38)
Location 9:88678646-88678668
Sequence CGTCTTCTTCCCAGGAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056676141_1056676145 -5 Left 1056676141 9:88678628-88678650 CCCTGGTTGCTGTGGAGCCGTCT No data
Right 1056676145 9:88678646-88678668 CGTCTTCTTCCCAGGAAACCTGG No data
1056676140_1056676145 -2 Left 1056676140 9:88678625-88678647 CCTCCCTGGTTGCTGTGGAGCCG No data
Right 1056676145 9:88678646-88678668 CGTCTTCTTCCCAGGAAACCTGG No data
1056676142_1056676145 -6 Left 1056676142 9:88678629-88678651 CCTGGTTGCTGTGGAGCCGTCTT No data
Right 1056676145 9:88678646-88678668 CGTCTTCTTCCCAGGAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056676145 Original CRISPR CGTCTTCTTCCCAGGAAACC TGG Intergenic
No off target data available for this crispr