ID: 1056678173

View in Genome Browser
Species Human (GRCh38)
Location 9:88694640-88694662
Sequence CCTGTTACCACTGCTTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056678173_1056678176 -1 Left 1056678173 9:88694640-88694662 CCATGGCAAGCAGTGGTAACAGG No data
Right 1056678176 9:88694662-88694684 GAAGATTCAGCCTATTCCCTGGG No data
1056678173_1056678181 17 Left 1056678173 9:88694640-88694662 CCATGGCAAGCAGTGGTAACAGG No data
Right 1056678181 9:88694680-88694702 CTGGGGATGAGTAATAACCATGG No data
1056678173_1056678182 18 Left 1056678173 9:88694640-88694662 CCATGGCAAGCAGTGGTAACAGG No data
Right 1056678182 9:88694681-88694703 TGGGGATGAGTAATAACCATGGG No data
1056678173_1056678177 0 Left 1056678173 9:88694640-88694662 CCATGGCAAGCAGTGGTAACAGG No data
Right 1056678177 9:88694663-88694685 AAGATTCAGCCTATTCCCTGGGG No data
1056678173_1056678175 -2 Left 1056678173 9:88694640-88694662 CCATGGCAAGCAGTGGTAACAGG No data
Right 1056678175 9:88694661-88694683 GGAAGATTCAGCCTATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056678173 Original CRISPR CCTGTTACCACTGCTTGCCA TGG (reversed) Intergenic
No off target data available for this crispr