ID: 1056678177

View in Genome Browser
Species Human (GRCh38)
Location 9:88694663-88694685
Sequence AAGATTCAGCCTATTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056678173_1056678177 0 Left 1056678173 9:88694640-88694662 CCATGGCAAGCAGTGGTAACAGG No data
Right 1056678177 9:88694663-88694685 AAGATTCAGCCTATTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056678177 Original CRISPR AAGATTCAGCCTATTCCCTG GGG Intergenic
No off target data available for this crispr