ID: 1056680737

View in Genome Browser
Species Human (GRCh38)
Location 9:88715602-88715624
Sequence CTTGACAGGGCCTCTTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056680737_1056680743 -3 Left 1056680737 9:88715602-88715624 CCTGATGAAGAGGCCCTGTCAAG No data
Right 1056680743 9:88715622-88715644 AAGGAACTGTGGGTATCCTCTGG No data
1056680737_1056680744 1 Left 1056680737 9:88715602-88715624 CCTGATGAAGAGGCCCTGTCAAG No data
Right 1056680744 9:88715626-88715648 AACTGTGGGTATCCTCTGGTCGG No data
1056680737_1056680746 21 Left 1056680737 9:88715602-88715624 CCTGATGAAGAGGCCCTGTCAAG No data
Right 1056680746 9:88715646-88715668 CGGCAGCCAGAGAGAAACAGAGG No data
1056680737_1056680748 28 Left 1056680737 9:88715602-88715624 CCTGATGAAGAGGCCCTGTCAAG No data
Right 1056680748 9:88715653-88715675 CAGAGAGAAACAGAGGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056680737 Original CRISPR CTTGACAGGGCCTCTTCATC AGG (reversed) Intergenic
No off target data available for this crispr