ID: 1056684497

View in Genome Browser
Species Human (GRCh38)
Location 9:88748390-88748412
Sequence TCTTAGAAGCAGAAAGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056684497_1056684500 19 Left 1056684497 9:88748390-88748412 CCTTCTACTTTCTGCTTCTAAGA No data
Right 1056684500 9:88748432-88748454 TGGTGCATATGTCTGTACTATGG No data
1056684497_1056684499 -1 Left 1056684497 9:88748390-88748412 CCTTCTACTTTCTGCTTCTAAGA No data
Right 1056684499 9:88748412-88748434 AGGTCAACTTCATTAGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056684497 Original CRISPR TCTTAGAAGCAGAAAGTAGA AGG (reversed) Intergenic
No off target data available for this crispr