ID: 1056685168

View in Genome Browser
Species Human (GRCh38)
Location 9:88753065-88753087
Sequence AGTCACCAACATCCAAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056685162_1056685168 -10 Left 1056685162 9:88753052-88753074 CCCCACCCCAGGCAGTCACCAAC No data
Right 1056685168 9:88753065-88753087 AGTCACCAACATCCAAGAAAAGG No data
1056685159_1056685168 -4 Left 1056685159 9:88753046-88753068 CCCCTACCCCACCCCAGGCAGTC No data
Right 1056685168 9:88753065-88753087 AGTCACCAACATCCAAGAAAAGG No data
1056685161_1056685168 -6 Left 1056685161 9:88753048-88753070 CCTACCCCACCCCAGGCAGTCAC No data
Right 1056685168 9:88753065-88753087 AGTCACCAACATCCAAGAAAAGG No data
1056685160_1056685168 -5 Left 1056685160 9:88753047-88753069 CCCTACCCCACCCCAGGCAGTCA No data
Right 1056685168 9:88753065-88753087 AGTCACCAACATCCAAGAAAAGG No data
1056685157_1056685168 9 Left 1056685157 9:88753033-88753055 CCACTGCATTACACCCCTACCCC No data
Right 1056685168 9:88753065-88753087 AGTCACCAACATCCAAGAAAAGG No data
1056685156_1056685168 25 Left 1056685156 9:88753017-88753039 CCACACAGCATCACTTCCACTGC No data
Right 1056685168 9:88753065-88753087 AGTCACCAACATCCAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056685168 Original CRISPR AGTCACCAACATCCAAGAAA AGG Intergenic
No off target data available for this crispr