ID: 1056687214

View in Genome Browser
Species Human (GRCh38)
Location 9:88776541-88776563
Sequence TTCCAAAAGGGGAAAATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056687214_1056687225 27 Left 1056687214 9:88776541-88776563 CCCCCCATTTTCCCCTTTTGGAA No data
Right 1056687225 9:88776591-88776613 ACTTATACCATCATTGAATTTGG No data
1056687214_1056687222 -5 Left 1056687214 9:88776541-88776563 CCCCCCATTTTCCCCTTTTGGAA No data
Right 1056687222 9:88776559-88776581 TGGAACCAGAATGTCTATAATGG No data
1056687214_1056687226 30 Left 1056687214 9:88776541-88776563 CCCCCCATTTTCCCCTTTTGGAA No data
Right 1056687226 9:88776594-88776616 TATACCATCATTGAATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056687214 Original CRISPR TTCCAAAAGGGGAAAATGGG GGG (reversed) Intergenic
No off target data available for this crispr