ID: 1056689102

View in Genome Browser
Species Human (GRCh38)
Location 9:88791082-88791104
Sequence AAATTCTGCTTCAAAAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056689102_1056689103 -4 Left 1056689102 9:88791082-88791104 CCAATTTTTTTGAAGCAGAATTT No data
Right 1056689103 9:88791101-88791123 ATTTTGCTTTTTTCTCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056689102 Original CRISPR AAATTCTGCTTCAAAAAAAT TGG (reversed) Intergenic