ID: 1056690969

View in Genome Browser
Species Human (GRCh38)
Location 9:88808433-88808455
Sequence AAATTGCAAGACATGTATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056690965_1056690969 19 Left 1056690965 9:88808391-88808413 CCACTAACAATTGCCTAAGCTGT No data
Right 1056690969 9:88808433-88808455 AAATTGCAAGACATGTATCCTGG No data
1056690967_1056690969 6 Left 1056690967 9:88808404-88808426 CCTAAGCTGTTATACATGGCACA No data
Right 1056690969 9:88808433-88808455 AAATTGCAAGACATGTATCCTGG No data
1056690964_1056690969 20 Left 1056690964 9:88808390-88808412 CCCACTAACAATTGCCTAAGCTG No data
Right 1056690969 9:88808433-88808455 AAATTGCAAGACATGTATCCTGG No data
1056690963_1056690969 30 Left 1056690963 9:88808380-88808402 CCAGCTTAAACCCACTAACAATT No data
Right 1056690969 9:88808433-88808455 AAATTGCAAGACATGTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056690969 Original CRISPR AAATTGCAAGACATGTATCC TGG Intergenic
No off target data available for this crispr