ID: 1056691995

View in Genome Browser
Species Human (GRCh38)
Location 9:88815715-88815737
Sequence GAGCAGACACTCCGCTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056691995_1056691999 21 Left 1056691995 9:88815715-88815737 CCCCAGAAGCGGAGTGTCTGCTC No data
Right 1056691999 9:88815759-88815781 AGGTTGTGCACCAAAGCAGAAGG No data
1056691995_1056691998 1 Left 1056691995 9:88815715-88815737 CCCCAGAAGCGGAGTGTCTGCTC No data
Right 1056691998 9:88815739-88815761 AAAGCGTGAATTTGTGCAAAAGG No data
1056691995_1056692000 22 Left 1056691995 9:88815715-88815737 CCCCAGAAGCGGAGTGTCTGCTC No data
Right 1056692000 9:88815760-88815782 GGTTGTGCACCAAAGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056691995 Original CRISPR GAGCAGACACTCCGCTTCTG GGG (reversed) Intergenic