ID: 1056695140

View in Genome Browser
Species Human (GRCh38)
Location 9:88842320-88842342
Sequence CTGTAAAGTCAGATGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056695140_1056695143 23 Left 1056695140 9:88842320-88842342 CCATCTTTCATCTGACTTTACAG 0: 1
1: 0
2: 1
3: 25
4: 287
Right 1056695143 9:88842366-88842388 TGAGTAGTAGTTGAGAAACAGGG 0: 1
1: 1
2: 1
3: 17
4: 217
1056695140_1056695142 22 Left 1056695140 9:88842320-88842342 CCATCTTTCATCTGACTTTACAG 0: 1
1: 0
2: 1
3: 25
4: 287
Right 1056695142 9:88842365-88842387 CTGAGTAGTAGTTGAGAAACAGG 0: 1
1: 0
2: 0
3: 10
4: 179
1056695140_1056695144 28 Left 1056695140 9:88842320-88842342 CCATCTTTCATCTGACTTTACAG 0: 1
1: 0
2: 1
3: 25
4: 287
Right 1056695144 9:88842371-88842393 AGTAGTTGAGAAACAGGGTTTGG 0: 1
1: 0
2: 2
3: 23
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056695140 Original CRISPR CTGTAAAGTCAGATGAAAGA TGG (reversed) Intergenic
906420770 1:45664986-45665008 CTGTTAAAAAAGATGAAAGATGG + Intronic
906791611 1:48663242-48663264 CTGTAAGATAAAATGAAAGATGG + Intronic
906957339 1:50385936-50385958 TAGTAAGGTCATATGAAAGATGG + Intergenic
907989392 1:59564825-59564847 CGGCAAAGTCAGGTGAAACAAGG + Intronic
909175514 1:72352997-72353019 TTGTAAAGCTACATGAAAGAGGG - Intergenic
909376861 1:74950949-74950971 CTGTAAAATCAAAAGAAAGTTGG - Intergenic
909674409 1:78223386-78223408 CTGTAAAGTCTTCTGAAATAAGG - Intergenic
909696955 1:78478346-78478368 CTGAAATGTAACATGAAAGATGG + Intronic
909831040 1:80190330-80190352 CTGAAAAGTCAGGGGAAAAAAGG + Intergenic
910669064 1:89755030-89755052 TTGTAAAGGCAGATCAAAGATGG - Intronic
910715628 1:90226157-90226179 CTGTAAAGTCAAAAGCAAGTTGG - Intergenic
911866196 1:103025953-103025975 CTGTAAAATGTGGTGAAAGATGG + Intronic
914335627 1:146712589-146712611 GTGTAGAGTCAGAGGAAGGAAGG + Intergenic
916598718 1:166271882-166271904 CTGTAACCTCAGATGGCAGAAGG + Intergenic
916791469 1:168129113-168129135 CTGTAAAGAAAGATCAAACAGGG + Intronic
917612296 1:176700772-176700794 CAGCAAAGTCACATGATAGAGGG + Intronic
918895385 1:190336894-190336916 AGGTAAAGTCAGAAGAAGGAAGG - Intronic
919527341 1:198669802-198669824 CTGTAAAGTCAACTGAATGATGG + Intronic
919936291 1:202252850-202252872 CTTGAAAGTCAGAGGGAAGAAGG + Intronic
922165589 1:223113145-223113167 CTGTGGAGTCAGAGGAATGAAGG - Intronic
922899704 1:229126823-229126845 CTAAAAGGTCAGAAGAAAGATGG + Intergenic
922987198 1:229874954-229874976 CTGTAAAGGGAGAGGAAAAATGG + Intergenic
922992704 1:229928889-229928911 CTGTAACATCAGCTGTAAGAAGG + Intergenic
923909052 1:238418975-238418997 TTGTAAAGTCAGAGGCAGGAAGG - Intergenic
924867081 1:247995002-247995024 AGGTAGAGTCAGATGAAGGAAGG - Intronic
1063841381 10:10075876-10075898 CTTTAAAGGCAGATGAAGGTGGG - Intergenic
1067728484 10:48791612-48791634 TGGTAAAGTCAGATGAGACATGG + Intronic
1068439522 10:57032888-57032910 CTGTAAAATCAAAAGCAAGATGG - Intergenic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070290440 10:75110386-75110408 CTGAGAAGTCACATGAGAGAGGG - Intronic
1071481159 10:86066078-86066100 CTGAAAAGACAGATTAAAGAGGG + Intronic
1072132095 10:92504189-92504211 TTCTAAAGTCAAATGATAGAGGG - Intronic
1072616855 10:97055778-97055800 ATGTCAAATCAGATGAAATACGG - Intronic
1072687086 10:97543947-97543969 CTGTTAAGTTAGTTGAAACAAGG + Intronic
1072964107 10:99956373-99956395 CTCTGAAGTCAGATGACCGAGGG + Exonic
1073098858 10:100996920-100996942 CTGTGAAGTCAGAGGCCAGAGGG + Intronic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1074326120 10:112453071-112453093 CTGTAAAGTCATCAGAAACAAGG - Intronic
1075909240 10:126109127-126109149 CTGGAAGGTCAGATTAGAGAGGG - Intronic
1076598722 10:131643258-131643280 CTGCAAGGCCACATGAAAGAGGG + Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1078557716 11:12343907-12343929 CTGTAAGGCCAGGTGAAAGATGG + Intronic
1079880232 11:25918631-25918653 CTTTAAGGCCAGATGAAAAATGG + Intergenic
1080904772 11:36531874-36531896 CATTAAAGTCAGAAGGAAGAAGG - Intronic
1081415951 11:42816398-42816420 CTGCCAAGTCAGATGTAAGATGG - Intergenic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1082024862 11:47564949-47564971 CTGTTTGGTCAGATGAAGGAGGG + Intronic
1084096674 11:66915862-66915884 CTGTAAAGGACGAAGAAAGAAGG - Intronic
1085272696 11:75279615-75279637 CTGTAAAGGGTGATGACAGAAGG + Intronic
1085822397 11:79806684-79806706 CGTTTAAGTCAGATGAAAGAAGG - Intergenic
1087408277 11:97756767-97756789 CTATAAAGTAGGAGGAAAGAGGG - Intergenic
1088149548 11:106727213-106727235 GTGTAAGGTCTGAAGAAAGAAGG + Intronic
1090218526 11:124994176-124994198 CTGTTTGGTCAGCTGAAAGACGG + Intronic
1090289813 11:125532861-125532883 CTGTAAAGTCAGATGTTTGTAGG - Intergenic
1090367194 11:126216464-126216486 CTGTAAAGACAGAGGAAAAGAGG - Intronic
1093535653 12:20219668-20219690 CTATAAAGTGACATGACAGAGGG + Intergenic
1097240430 12:57571461-57571483 TTTTAAAATCAGATGGAAGAAGG + Intronic
1097945914 12:65367212-65367234 TTGTAAAGCCAGATGAAAGAGGG + Intronic
1098170853 12:67745426-67745448 CTGTGAAGGAAGATGAAGGAAGG - Intergenic
1098305819 12:69101633-69101655 CTGTAACGTGAGATGAAACATGG + Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1098506295 12:71255324-71255346 AAATAAAATCAGATGAAAGAAGG + Intronic
1098989327 12:77047556-77047578 CTGGCAAGTGAAATGAAAGAAGG - Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1100707302 12:97215370-97215392 CAGCAAAGTCAGATTAAATAAGG - Intergenic
1101255900 12:102976214-102976236 GTGTAAAGTGGGATCAAAGAAGG - Intergenic
1102159940 12:110760415-110760437 CTGTGAAGACAGGTGGAAGACGG + Intergenic
1102336222 12:112082737-112082759 CTTCAAAGTCATCTGAAAGATGG - Intronic
1103196475 12:119047877-119047899 CTGCAAAGTCATATGACAAAGGG + Intronic
1103415574 12:120739931-120739953 TTGTAAAGTCTGATGAAGGCAGG + Exonic
1103586326 12:121958947-121958969 CTGTAAAGCCAGCTCCAAGAAGG - Exonic
1106596644 13:31147054-31147076 CTGGAAAGTGGGATGTAAGATGG + Intronic
1106756225 13:32825709-32825731 CTTAAAAGTTAGAAGAAAGATGG - Intergenic
1106786441 13:33112741-33112763 CAATAAATTAAGATGAAAGAGGG + Exonic
1107371363 13:39753255-39753277 CTGTAACGTCACATGGTAGAAGG - Intronic
1107824286 13:44313482-44313504 CTGTAAAATCAAATAAAACATGG + Intergenic
1108109730 13:47055869-47055891 TTGAAATGTCAGATGAAATAAGG + Intergenic
1108535173 13:51369230-51369252 GTGTAATGTCTGATGAAAGTTGG + Exonic
1109210017 13:59524420-59524442 CTGTAAAATTATTTGAAAGAAGG - Intergenic
1109235222 13:59809779-59809801 CTGTAAAGTGAAAGTAAAGAAGG + Intronic
1109413738 13:62008424-62008446 CTGGAACATCAGATGTAAGAGGG + Intergenic
1109533769 13:63688465-63688487 CTGTAAAGGCAAATGAAAAATGG - Intergenic
1109549398 13:63873529-63873551 CTTGAAAGTCACATGAGAGAAGG - Intergenic
1109838240 13:67886939-67886961 TTCTAAGGCCAGATGAAAGATGG - Intergenic
1109991045 13:70058061-70058083 CTTAAAAATCAGATGATAGAAGG + Intronic
1110261828 13:73493372-73493394 CTGGTGAGTGAGATGAAAGAGGG + Intergenic
1111036086 13:82676730-82676752 CTGTAAAGTCAAAAGCAAGTTGG + Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111917698 13:94378459-94378481 CTGTAAAATTAGACAAAAGAGGG - Intronic
1113178093 13:107589899-107589921 CTGACATCTCAGATGAAAGATGG + Intronic
1116426894 14:44801455-44801477 CTGTAATGGTAGATGAAACATGG + Intergenic
1119147825 14:72332691-72332713 CTGAAAAGTGAGATGAGACAAGG - Intronic
1121358574 14:93234777-93234799 GTTTAAAGGAAGATGAAAGAGGG - Intergenic
1121913606 14:97815787-97815809 CAGCAGAGTCAGATGAAAGGTGG + Intergenic
1126214833 15:46143189-46143211 ATATAAGGTCAGAAGAAAGAAGG + Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127249451 15:57215917-57215939 CAGAAAAGTAAGATGGAAGAGGG + Intronic
1127261808 15:57331994-57332016 CTGTAAAGTCAGGTGGAAAGTGG - Intergenic
1128060671 15:64733689-64733711 CTGTAAAATTAGATGATTGATGG + Intergenic
1128350582 15:66885752-66885774 CTGTAACCTCAAATGAAGGAAGG + Intergenic
1128877184 15:71211978-71212000 CTGTAAGGCAAGATGCAAGATGG - Intronic
1130744983 15:86642166-86642188 CTGTAAAGTCATATGGAAACAGG + Intronic
1130764621 15:86857435-86857457 ATGTGAAAACAGATGAAAGAAGG - Intronic
1134674992 16:16083949-16083971 CTGCAGAGTCACATGACAGAGGG + Intronic
1135343871 16:21671240-21671262 CTGTAAAATGAGATTAATGATGG - Intergenic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1139728456 16:68921841-68921863 CTGCAAAGTCAGAGGAATGCCGG - Intronic
1139917560 16:70438037-70438059 CTGTAAAGCAAGAGGGAAGATGG + Intronic
1139997999 16:70998639-70998661 GTGTAGAGTCAGAGGAAGGAAGG - Intronic
1140725884 16:77811727-77811749 CTGTAAAGTCTCCTGAGAGATGG - Intronic
1140819546 16:78650090-78650112 CTGAAATGTCAGAGGAAGGAGGG + Intronic
1145097642 17:20044768-20044790 CTGTAAAGTTATATTAAAGTGGG + Intronic
1145829896 17:27907450-27907472 ATGGAGAGTCAGAGGAAAGAGGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147275312 17:39311321-39311343 CAGTAAAGTGTAATGAAAGAAGG - Intronic
1148461679 17:47842609-47842631 CAGTAAAGTCAGAGGATACAAGG - Intergenic
1149096399 17:52846350-52846372 CTGCAAAGTCATATCAAAAAAGG + Intergenic
1149115104 17:53084458-53084480 CTGTAACCCCAGATGAAAAATGG + Intergenic
1149447367 17:56724063-56724085 CTGTAAAGTCACATGGAAAAAGG + Intergenic
1151603692 17:75122978-75123000 CTGTAATTTAAGATGAAGGAGGG - Intronic
1152197970 17:78928628-78928650 CTGCAAAGTCAGATGAAGAGGGG + Intergenic
1152435372 17:80273218-80273240 CTGTAACGGCAGATGAAGGAAGG - Intronic
1154194466 18:12255191-12255213 CTGTAAAGTAAGGTCTAAGAGGG + Intronic
1155570380 18:27185483-27185505 CCAGAAAGTCAGAGGAAAGAGGG - Intergenic
1155619916 18:27767096-27767118 CTCTAACCTCAGATGACAGAAGG + Intergenic
1155992051 18:32287902-32287924 CTGGAACTTCAGATGCAAGAGGG - Exonic
1156282352 18:35652336-35652358 ATGAAAAGTCAGAGGAAGGAAGG - Intronic
1158060921 18:53340416-53340438 CTGCAAAAGAAGATGAAAGAAGG + Intronic
1159095734 18:63899411-63899433 CTGGAAATTCAGAAGAATGAAGG - Intronic
1159525614 18:69584949-69584971 CTGGCAAGCTAGATGAAAGAAGG - Intronic
1160109850 18:76015928-76015950 CTGTAAAAGCAAATGAAAGCAGG + Intergenic
1164228587 19:23267917-23267939 CTGTAAAGTGAGATCATTGAAGG - Intergenic
1168311696 19:55463968-55463990 CTGTAAAGACAGATGTGAGCAGG + Intergenic
925504323 2:4543903-4543925 CTGTAACCTCATATGAAAGAAGG + Intergenic
926756789 2:16242979-16243001 CTGTAAAGCCAGAAGAGACAGGG - Intergenic
927001828 2:18803560-18803582 CTGTAAAATAAGATAGAAGAAGG - Intergenic
928114309 2:28536009-28536031 CTGTAAAGTCAGGTGGCAGCTGG - Intronic
929191245 2:39142113-39142135 CTAGAAAGATAGATGAAAGAGGG - Intergenic
930498254 2:52176215-52176237 CTTTAAAGGCAGCTGAGAGAAGG - Intergenic
930605948 2:53493179-53493201 CTGTAAACTCACATGGGAGAAGG - Intergenic
932986620 2:76733648-76733670 AGGGAAAGCCAGATGAAAGAGGG + Intergenic
933073190 2:77888762-77888784 TTGTGAAGTTAGAAGAAAGATGG - Intergenic
933126733 2:78618579-78618601 CTGAAAAGTCACTTGAAATAAGG - Intergenic
933405800 2:81857974-81857996 CTGTAAGGTCACATTACAGAAGG - Intergenic
934098873 2:88632766-88632788 CTGCAAAGTCATGTGACAGAGGG + Intergenic
934613902 2:95759651-95759673 ATGGATAGACAGATGAAAGATGG + Intergenic
935261870 2:101362751-101362773 CTCTAAAGTCAGGTGAAAGGGGG - Intronic
936028155 2:109049606-109049628 TTGTTAAATCAGAAGAAAGAGGG - Intergenic
936253947 2:110892805-110892827 CTGTCAAGTCAGTTGGAAGGAGG + Intronic
939501368 2:142989310-142989332 CAGAAAAGTAAGATGACAGAAGG - Intronic
939690771 2:145257646-145257668 CTATAAAGTCACATGGAAGATGG + Intergenic
939770322 2:146308025-146308047 CTGCAAACTCAGGTGAGAGAAGG + Intergenic
940533020 2:154904346-154904368 CTGTAAAGTCAAAAGTAAGTTGG + Intergenic
941577750 2:167255686-167255708 CTGAAAACTAAGATGAAATAAGG - Intronic
941722922 2:168831227-168831249 CTGTAACCTCAGATGGCAGAAGG + Intronic
942566042 2:177265150-177265172 CGGTAAAGTGAGATAAAAGCAGG - Intronic
943868424 2:192959298-192959320 CTGTATCGTCACATGGAAGAAGG - Intergenic
943882282 2:193160965-193160987 CTGTCAAGTCAGAAGATTGAGGG + Intergenic
943895200 2:193348660-193348682 ATTAAAAGTCAGATTAAAGAAGG - Intergenic
943957681 2:194213729-194213751 CAGTATAGTCAGATAAAATAGGG + Intergenic
946545089 2:220731919-220731941 TTCTAAAGACAGATGAAAGGTGG - Intergenic
1168781743 20:497608-497630 TTGTAAAGTATGTTGAAAGAAGG - Intronic
1169532303 20:6498717-6498739 CAGTAAAGTCTTCTGAAAGATGG - Intergenic
1170532550 20:17309025-17309047 CTGAAAAGTCACATGGCAGAGGG + Intronic
1171071489 20:22073094-22073116 CTTTAGAGTCAGATAAATGAGGG - Intergenic
1173849182 20:46207192-46207214 CGGCAAAGAGAGATGAAAGAAGG + Intronic
1174812777 20:53661403-53661425 TTGTCAAGTCAGATCAAAGATGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177703943 21:24675517-24675539 CTGGAAAGTCTGTGGAAAGAAGG - Intergenic
1184003850 22:41694655-41694677 GTGGAAATTCAGATGGAAGAGGG + Exonic
951465642 3:22997865-22997887 GAGTGAAGTCAGATGAAAGTGGG + Intergenic
951678345 3:25267403-25267425 CGGTAATGTGAGGTGAAAGACGG - Intronic
952191396 3:31026773-31026795 CTGTAAACTCAAATTAGAGAGGG + Intergenic
952772349 3:37013626-37013648 CTGCAAAGTCAGCTGAGAGCAGG - Intronic
956983577 3:74669517-74669539 ATGTAAAGTCAGAGGACAGTTGG + Intergenic
957253847 3:77811444-77811466 CTCTAAAGTCATATGACAAAGGG - Intergenic
959151955 3:102618496-102618518 CTTGAAGGTCAGATGCAAGATGG + Intergenic
959685156 3:109137316-109137338 CTTTAAAGGCAGATCAAGGAAGG + Intergenic
959821831 3:110744471-110744493 TTATAAAGTCATGTGAAAGAAGG - Intergenic
960462802 3:117957653-117957675 TTGTAATGCCAAATGAAAGAAGG + Intergenic
960551839 3:118984612-118984634 ATGTAAATTCAAATGAAAGAGGG + Intronic
961078349 3:124002934-124002956 ATAGAAAGTGAGATGAAAGATGG + Intergenic
963351472 3:144157352-144157374 CTGTAAAATGAGATGTTAGAAGG + Intergenic
970045320 4:11846229-11846251 GTGTAAAGTCAAAGGAAAGGAGG + Intergenic
971362542 4:25951172-25951194 CTGTTAAGTCTGATGCAAGCTGG - Intergenic
971594637 4:28513938-28513960 TTGGAAAGTCAGATAATAGATGG + Intergenic
971926397 4:33014650-33014672 CTGTAAAGTGAGTTGAAATGGGG + Intergenic
972242633 4:37209833-37209855 CTGTAAAATTAAATGAGAGAAGG - Intergenic
972665447 4:41160671-41160693 TTGCAATGTGAGATGAAAGAGGG - Intronic
973233972 4:47876519-47876541 ATGAGAAGTCAGATGAAAGTTGG + Intronic
973733871 4:53850832-53850854 CTCAAAAGTCTGATCAAAGAAGG + Intronic
974212359 4:58795583-58795605 CTGTAAATTGAGAAGAAAGAAGG + Intergenic
975078688 4:70247304-70247326 CTATAAAAACAAATGAAAGATGG + Intronic
975337604 4:73198030-73198052 CTCTAAAGTTAGAGGAATGATGG - Intronic
975474476 4:74807425-74807447 CTGCAACTTCAGTTGAAAGAAGG + Intergenic
975858276 4:78648352-78648374 CAGAAAAGAAAGATGAAAGAAGG - Intergenic
977450207 4:97186293-97186315 CTGTAGAGTCACATGAACAATGG - Intronic
979966983 4:127087208-127087230 CTGTAAAATCAGAAGCAAGTTGG - Intergenic
980040372 4:127932722-127932744 CATAAAACTCAGATGAAAGAGGG + Intronic
980270960 4:130583161-130583183 AAGTAAAGTCATTTGAAAGAGGG + Intergenic
980808195 4:137840781-137840803 CTGCAAATTCAGCTGAAATAAGG + Intergenic
980819495 4:137994915-137994937 CTTTGAAGTTAGATGCAAGATGG + Intergenic
981874515 4:149524989-149525011 CTTTAAAGTCAATTGAAACAGGG + Intergenic
981923239 4:150109952-150109974 CTGAAAAGTGTGAAGAAAGAAGG + Intronic
982123871 4:152167777-152167799 TTTTAAAGTGAAATGAAAGATGG + Intergenic
982131793 4:152235336-152235358 CTCAAAATTCAGATGAAATAAGG + Intergenic
983440424 4:167776157-167776179 CTCTAAAGTCAGATGTATAAAGG + Intergenic
983856512 4:172653007-172653029 TTTTAAAGTCAGATGAAAGCTGG - Intronic
983889587 4:173016649-173016671 CTGTAAAATCAAATGCAAGTTGG - Intronic
984183184 4:176510309-176510331 CTGTAAAGTTATATGGTAGAGGG - Intergenic
984595366 4:181661210-181661232 GTGTAAAGTAAGATCAAGGAAGG - Intergenic
986861342 5:11929678-11929700 CTGTAAGGACAGATGTGAGATGG + Intergenic
988368089 5:30328602-30328624 CTGTAACTTCACATGACAGAAGG + Intergenic
988503760 5:31804202-31804224 ATGAAAAGCCAGGTGAAAGAGGG + Intronic
989535289 5:42556606-42556628 GTGTAAAGTAAGATATAAGAAGG + Intronic
989703443 5:44298324-44298346 CTGTATCCTCAGATGACAGAAGG - Intergenic
989763778 5:45053628-45053650 CTGTAAATTTAGATGAATAAAGG - Intergenic
990356914 5:54976717-54976739 CAATAAAATCAGATGAAAGTGGG - Intergenic
991335147 5:65538866-65538888 CTTTAAAGTCAGAATATAGATGG - Intronic
991907705 5:71528621-71528643 CTGTAAAGTCACATTTATGAAGG + Intronic
993416538 5:87639895-87639917 CTGTAAAGCTAGAAGCAAGATGG + Intergenic
993416823 5:87643958-87643980 CTGTAAAGCAACATGATAGATGG - Intergenic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
998084794 5:139311334-139311356 CTGTAAAATCAGATTAATAAAGG - Intronic
999078887 5:148825044-148825066 CAGTAAAGTCACATGCCAGATGG + Intergenic
999131847 5:149289633-149289655 TTGTAAATTCAGAGGAAGGAAGG + Intronic
999955596 5:156697924-156697946 CTCTCAAGTCAGGAGAAAGAGGG + Intronic
1001352753 5:170985916-170985938 ATGTAAATTCAGAAGAATGAAGG - Intronic
1001395598 5:171418020-171418042 CTATAAAGCAAGATCAAAGACGG + Intergenic
1001458529 5:171887545-171887567 CTGAAAAGTAAGGGGAAAGAGGG + Intronic
1001780202 5:174361705-174361727 CTATAATGTCAAAAGAAAGAAGG - Intergenic
1002165464 5:177341675-177341697 ATGTAAAGTCAGATTCCAGAAGG + Intronic
1003199849 6:3949370-3949392 CTGTGAAGTTAGAAGCAAGATGG + Intergenic
1003585869 6:7389017-7389039 CTGTAAGGACAAATGAAAGATGG - Intronic
1005156266 6:22810277-22810299 CTTTTAAGTAACATGAAAGAAGG + Intergenic
1005498342 6:26408215-26408237 ATGTAAAGTCAAATGACAAAAGG + Intronic
1005524727 6:26634755-26634777 CAGTAAGATCAGTTGAAAGAAGG + Exonic
1006548891 6:34803940-34803962 CTTTAAACTTGGATGAAAGAAGG + Intronic
1006940867 6:37751564-37751586 CTGTGGAGTCAGATGACAAAGGG - Intergenic
1007556046 6:42767437-42767459 CTGCAAACACAGATGATAGATGG + Intronic
1009969128 6:70608024-70608046 TTTGAAAGTCAGATGAAGGATGG - Intergenic
1010451659 6:76010835-76010857 CAGTAGAGACAGATGAAAAAAGG - Intronic
1010628307 6:78166581-78166603 CTGTAATCTCACATGAAAGAAGG + Intergenic
1012100581 6:95081104-95081126 CCGTAAAGTCAGAAGAAATGAGG + Intergenic
1013734089 6:113205641-113205663 CAGTAAAATCAAAGGAAAGAGGG - Intergenic
1016885220 6:148953237-148953259 CTTTAAAGTCAAATCAAGGAAGG - Intronic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1017545650 6:155448713-155448735 CTGAAAAATAAAATGAAAGAAGG - Intronic
1017599151 6:156061892-156061914 TTGTAAAATCAGGTGAAGGAAGG + Intergenic
1017939808 6:159041826-159041848 CTGTGAAGTCAGAGGAATGGCGG + Intronic
1018573202 6:165232236-165232258 CTGGAGACTGAGATGAAAGAGGG - Intergenic
1019902806 7:4036737-4036759 CTGTAATCTCATATGACAGAAGG - Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020432317 7:8126765-8126787 AATTAAAGTCACATGAAAGAAGG + Intronic
1020668099 7:11072905-11072927 CTGTTAGTTCACATGAAAGATGG - Intronic
1021426322 7:20503539-20503561 CTAGAAAGACAGATGAAAGTTGG + Intergenic
1022684026 7:32577907-32577929 CTGGAAAGTCAGCTGACAAAAGG + Intronic
1023838928 7:44084747-44084769 CTGTGAGGTTAGATGCAAGAGGG - Intergenic
1024305401 7:47924748-47924770 CTGTGAAGTTAGAAGCAAGATGG + Intronic
1024443659 7:49452265-49452287 CTAGAAATTCAGATGAAAGCAGG + Intergenic
1024522252 7:50315683-50315705 CTGTAAAGGGAGATGCCAGAAGG - Intronic
1026332926 7:69368716-69368738 CTTTCAAGGCAGAAGAAAGAAGG + Intergenic
1026519392 7:71103248-71103270 CTGTGAAGTTAGAAGCAAGATGG + Intergenic
1026828660 7:73598765-73598787 CTGAAAAGTCTGATGATGGAGGG + Intronic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1028799572 7:94947593-94947615 CTGTAAAGTGACATGCTAGAAGG + Intronic
1029171552 7:98633146-98633168 CTTTTAAATCAGATAAAAGAAGG - Intergenic
1031677594 7:124630605-124630627 CTGCAAATTAAGATGACAGATGG + Intergenic
1031967140 7:128034596-128034618 CTATAAAGGTAGATGAAAGTGGG + Intronic
1033819858 7:145122277-145122299 CTGAAAAGTCTGATGCCAGATGG + Intergenic
1034530841 7:151695571-151695593 TTGCAAAATCAGTTGAAAGAGGG - Intronic
1037482621 8:19318542-19318564 CGGTAAAGTCATATAAATGAAGG + Intronic
1037489941 8:19388591-19388613 TTTAAAAATCAGATGAAAGATGG - Intronic
1037856404 8:22374351-22374373 GTGGAAAGTCAGATGCAGGATGG + Intronic
1039232575 8:35464902-35464924 CTGTAAAGGCAGAACAGAGAAGG - Intronic
1040884079 8:52240464-52240486 CTGTTAAACCAGAAGAAAGAAGG - Intronic
1041036793 8:53799807-53799829 CTGTAAACTCAGATGGCAGAGGG - Intronic
1041240323 8:55843645-55843667 CTGTGAAGACAGAGAAAAGATGG + Intergenic
1043424122 8:80131893-80131915 CTGTCAAGTCAGAAGAACTAGGG + Intronic
1044907923 8:97024925-97024947 CTGCAAAGTTAGATCACAGAAGG + Intronic
1046581944 8:116103844-116103866 CTGAAAAGTCATTTGAAAGAAGG - Intergenic
1046865857 8:119149658-119149680 CTGTATACTCATATGACAGAAGG - Intergenic
1047846667 8:128813778-128813800 ATGAAAAGTAGGATGAAAGACGG - Intergenic
1050754501 9:8984588-8984610 CTGAGAAGTCAGAAGAAAAATGG - Intronic
1052396627 9:27946786-27946808 CAGAAAAGTCAAATGAAAAATGG + Intergenic
1052859828 9:33430774-33430796 CCTTAAATTCAGATGAGAGAGGG - Intergenic
1053522147 9:38791148-38791170 CTGTAACATCAGATTAAATAGGG + Intergenic
1054194371 9:62015612-62015634 CTGTAACATCAGATTAAATAGGG + Intergenic
1054644036 9:67573078-67573100 CTGTAACATCAGATTAAATAGGG - Intergenic
1056202247 9:84288179-84288201 CTGCAATTTCAGAAGAAAGAAGG + Intronic
1056695140 9:88842320-88842342 CTGTAAAGTCAGATGAAAGATGG - Intergenic
1057536619 9:95915645-95915667 CTATAAAGTAAGAAAAAAGAAGG - Intronic
1057681918 9:97195718-97195740 CAGTAAGATCAGTTGAAAGAAGG + Intergenic
1058161468 9:101574642-101574664 CTGCAAAGTCACATTACAGAGGG - Intronic
1061772318 9:132935485-132935507 CTGTAAAGTTAGAATAATGATGG + Intronic
1061830042 9:133285905-133285927 CTGTAAGGACAAAGGAAAGAGGG - Intergenic
1185894609 X:3846397-3846419 CTGTGAGGTCTGATGGAAGATGG + Intergenic
1185899727 X:3884821-3884843 CTGTGAGGTCTGATGGAAGATGG + Intergenic
1185904843 X:3923250-3923272 CTGTGAGGTCTGATGGAAGATGG + Intergenic
1187083076 X:16011520-16011542 CTTTAAAATAAGATGACAGAAGG - Intergenic
1188970334 X:36607333-36607355 AAATAAAGTCAGATGAAAAAGGG + Intergenic
1189637102 X:43023057-43023079 CTGTAAAATCAAAAGAAAGTTGG + Intergenic
1190296024 X:49028360-49028382 CAGTAAAGTCAGGTGAGTGAGGG - Intergenic
1190553187 X:51606285-51606307 CTGTAAAAACAGATGACAGAAGG - Intergenic
1191161433 X:57333544-57333566 CTGTAATGTAAGAAGACAGATGG + Intronic
1192035401 X:67557586-67557608 CTATAAAGTAAAAGGAAAGAGGG - Intronic
1193240603 X:79164680-79164702 CTGTAAAGGCATAGGAAAAATGG + Intergenic
1194424634 X:93721457-93721479 TAGTAAAATCAGATGATAGATGG - Intergenic
1196406156 X:115364929-115364951 CTGTCAAGTCAAGTGGAAGAGGG - Intergenic
1196423906 X:115550542-115550564 CTGTAGAGTCAGACAAGAGATGG + Intergenic
1199195514 X:145025055-145025077 CTGTAAAAGTAAATGAAAGAAGG + Intergenic
1199853151 X:151739458-151739480 CTGCTAAGGAAGATGAAAGAAGG - Intronic
1200107334 X:153722349-153722371 CTGGAAAAGCAAATGAAAGAGGG - Intronic