ID: 1056697695

View in Genome Browser
Species Human (GRCh38)
Location 9:88873921-88873943
Sequence CAGGACAAGGAGAATGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056697695_1056697699 0 Left 1056697695 9:88873921-88873943 CCTGCTTCATTCTCCTTGTCCTG No data
Right 1056697699 9:88873944-88873966 GCCATGCAAATGCGCTTCTCAGG No data
1056697695_1056697704 24 Left 1056697695 9:88873921-88873943 CCTGCTTCATTCTCCTTGTCCTG No data
Right 1056697704 9:88873968-88873990 GGACCAGGAGCTGCCGAGGAAGG No data
1056697695_1056697703 20 Left 1056697695 9:88873921-88873943 CCTGCTTCATTCTCCTTGTCCTG No data
Right 1056697703 9:88873964-88873986 AGGAGGACCAGGAGCTGCCGAGG No data
1056697695_1056697706 26 Left 1056697695 9:88873921-88873943 CCTGCTTCATTCTCCTTGTCCTG No data
Right 1056697706 9:88873970-88873992 ACCAGGAGCTGCCGAGGAAGGGG No data
1056697695_1056697702 9 Left 1056697695 9:88873921-88873943 CCTGCTTCATTCTCCTTGTCCTG No data
Right 1056697702 9:88873953-88873975 ATGCGCTTCTCAGGAGGACCAGG No data
1056697695_1056697701 3 Left 1056697695 9:88873921-88873943 CCTGCTTCATTCTCCTTGTCCTG No data
Right 1056697701 9:88873947-88873969 ATGCAAATGCGCTTCTCAGGAGG No data
1056697695_1056697705 25 Left 1056697695 9:88873921-88873943 CCTGCTTCATTCTCCTTGTCCTG No data
Right 1056697705 9:88873969-88873991 GACCAGGAGCTGCCGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056697695 Original CRISPR CAGGACAAGGAGAATGAAGC AGG (reversed) Intergenic
No off target data available for this crispr