ID: 1056702405

View in Genome Browser
Species Human (GRCh38)
Location 9:88921797-88921819
Sequence TTGAACCCCCAAAGTGACCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056702403_1056702405 24 Left 1056702403 9:88921750-88921772 CCTGTGCTGAAGGTCTGCAAACT No data
Right 1056702405 9:88921797-88921819 TTGAACCCCCAAAGTGACCACGG No data
1056702402_1056702405 25 Left 1056702402 9:88921749-88921771 CCCTGTGCTGAAGGTCTGCAAAC No data
Right 1056702405 9:88921797-88921819 TTGAACCCCCAAAGTGACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056702405 Original CRISPR TTGAACCCCCAAAGTGACCA CGG Intergenic
No off target data available for this crispr