ID: 1056705015

View in Genome Browser
Species Human (GRCh38)
Location 9:88944283-88944305
Sequence CAGCAAACAGCAGTGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056705007_1056705015 23 Left 1056705007 9:88944237-88944259 CCTGCCAGATCCAGAGGGATGGA No data
Right 1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG No data
1056705010_1056705015 13 Left 1056705010 9:88944247-88944269 CCAGAGGGATGGAAGTCAGCGGT 0: 10
1: 44
2: 108
3: 118
4: 166
Right 1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG No data
1056705008_1056705015 19 Left 1056705008 9:88944241-88944263 CCAGATCCAGAGGGATGGAAGTC 0: 25
1: 61
2: 115
3: 90
4: 155
Right 1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG No data
1056705005_1056705015 24 Left 1056705005 9:88944236-88944258 CCCTGCCAGATCCAGAGGGATGG 0: 13
1: 43
2: 96
3: 162
4: 295
Right 1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056705015 Original CRISPR CAGCAAACAGCAGTGGTGGT TGG Intergenic
No off target data available for this crispr